• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Sophora Japonica


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GGATCATTGTCGATGCCTTACAAGCTGTACGACCCGTGCATTTGTTATACTATCGGGGCGGCTCAGGGTGTTTGACACCTCGAACCCCCTTAGCCAGGAGGCGCCCACCTCGTGTGGTTTCCTTCTGGCCAAACAACAAACCCCGGCGCCAAATGCGCCAAGGAACTCCAAATTGTTTAGTGCGCTCCCGTCGACCCGGACACGGTGCTCGTGCGGTGGGCGATGCGACATATGTTATCTAAAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAATGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAATGCAAGTTGCGCCCGAGGCCATTAGGTCGAGGGCACGTCTGCCTGGGCGTCACACATCGTTGCCCCAACGCCAGTTCCTCGTATTGCTAGGTCCTGAGCGGGGGCGAATGTTGGCTTCCCGTGAGCCTAGTCTCGCGGTTGGTTGAAAATGAGTCCGTGGTGGAGAGCACCACGATAGATGGTGGCCGAGTAAATCTCGAGACCGATCGCGCGTGTCTCTTCACCGGGTTCGGACCACGGGACCCACGGAGCATCATCATAATATACGATGGCCCATAACGAGACCTC

Click for details-----ITS1

GAACCTGCGGAAGGATCATTGTCGATGCCTCACAAGCAGTGCAACTCGTGAATTTGTTATACTATCGGGGCGGCTCAGGGTGTTTGACACCTCGAACCCCCTTAGCCAGGAGGCGCCCACCTCGTGTGGTTTCCTTCTGGCCAAAAACAAACCCCGGCGCCAAATGCGCCAAGGAACTCCAAATTGTTTAGTGCGCTCCCGTCGACCCGGACACGGTGCTCGTGCGGTGGGCGATGCGACATATGTTATCTAAAA

Click for details-----ITS2

ATCGTTGCCCCAATGCCAGTGCCTCTTGCTAGGTCCTGAGCGGGGCGAATGTTGGCTTCCCGTGAGCCTTGTCTCGCGGTTGGTTAAAAAATGTGTCTGTGGTGGAGAGCACCMCGATGGATGGTGGCTGAGTAAAATCTCGAGACCAATCGCGTGTGTCTCTTTGCCGGTTTTGGACTATGTGACCCACGGAGCATCATATACGATCGCCCCATAACGAGACCTCA
Taxonomic Information

Plant ID: NPO20846
Plant Latin Name: Sophora Japonica
Taxonomy Genus: Sophora
Taxonomy Family: Fabaceae

Plant External Links:

NCBI TaxonomyDB: 3897
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM


Medicinal Functions:

Abortifacient; Antibacterial; Anticholesterolemic; Antidiarrhoeal; Antiinflammatory; Antispasmodic; Diuretic; Emetic; Emollient; Febrifuge; Hypotensive; Purgative; Skin; Styptic; Tonic

Geographical Distribution

China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

148 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


63 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

50 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98939

Ingredient ID: NPC98743

Ingredient ID: NPC96428

Ingredient ID: NPC96294

Ingredient ID: NPC95247

Ingredient ID: NPC94186

Ingredient ID: NPC90305

Ingredient ID: NPC89088

Ingredient ID: NPC88090

Ingredient ID: NPC85715

Ingredient ID: NPC83497

Ingredient ID: NPC79943

Ingredient ID: NPC79765

Ingredient ID: NPC79056

Ingredient ID: NPC76545

Ingredient ID: NPC76336

Ingredient ID: NPC75613

Ingredient ID: NPC725

Ingredient ID: NPC67518

Ingredient ID: NPC6616

Ingredient ID: NPC6072

Ingredient ID: NPC5383

Ingredient ID: NPC51204

Ingredient ID: NPC49579

Ingredient ID: NPC46803

Ingredient ID: NPC46747

Ingredient ID: NPC45782

Ingredient ID: NPC44328

Ingredient ID: NPC43300

Ingredient ID: NPC41346

Ingredient ID: NPC39426

Ingredient ID: NPC38656

Ingredient ID: NPC37661

Ingredient ID: NPC34700

Ingredient ID: NPC328772

Ingredient ID: NPC32441

Ingredient ID: NPC313163

Ingredient ID: NPC311566

Ingredient ID: NPC311485

Ingredient ID: NPC306207

Ingredient ID: NPC304769

Ingredient ID: NPC302770

Ingredient ID: NPC302556

Ingredient ID: NPC298825

Ingredient ID: NPC296970

Ingredient ID: NPC296020

Ingredient ID: NPC294815

Ingredient ID: NPC292893

Ingredient ID: NPC29280

Ingredient ID: NPC290598

Ingredient ID: NPC287349

Ingredient ID: NPC286388

Ingredient ID: NPC283389

Ingredient ID: NPC28239

Ingredient ID: NPC278948

Ingredient ID: NPC277222

Ingredient ID: NPC272085

Ingredient ID: NPC270797

Ingredient ID: NPC268356

Ingredient ID: NPC266483

Ingredient ID: NPC265885

Ingredient ID: NPC262093

Ingredient ID: NPC261566

Ingredient ID: NPC250828

Ingredient ID: NPC250069

Ingredient ID: NPC246469

Ingredient ID: NPC244486

Ingredient ID: NPC244315

Ingredient ID: NPC243728

Ingredient ID: NPC241471

Ingredient ID: NPC239881

Ingredient ID: NPC239312

Ingredient ID: NPC238100

Ingredient ID: NPC237435

Ingredient ID: NPC237255

Ingredient ID: NPC236726

Ingredient ID: NPC235839

Ingredient ID: NPC233169

Ingredient ID: NPC230861

Ingredient ID: NPC226087

Ingredient ID: NPC220210

Ingredient ID: NPC219876

Ingredient ID: NPC219090

Ingredient ID: NPC219040

Ingredient ID: NPC218109

Ingredient ID: NPC216230

Ingredient ID: NPC213182

Ingredient ID: NPC211913

Ingredient ID: NPC20791

Ingredient ID: NPC206264

Ingredient ID: NPC204145

Ingredient ID: NPC201248

Ingredient ID: NPC197896

Ingredient ID: NPC197396

Ingredient ID: NPC192877

Ingredient ID: NPC192818

Ingredient ID: NPC187512

Ingredient ID: NPC187508

Ingredient ID: NPC18729

Ingredient ID: NPC182321

Ingredient ID: NPC181465

Ingredient ID: NPC179950

Ingredient ID: NPC17810

Ingredient ID: NPC178014

Ingredient ID: NPC177771

Ingredient ID: NPC177731

Ingredient ID: NPC176740

Ingredient ID: NPC17521

Ingredient ID: NPC173637

Ingredient ID: NPC173582

Ingredient ID: NPC167922

Ingredient ID: NPC166409

Ingredient ID: NPC162822

Ingredient ID: NPC16194

Ingredient ID: NPC15970

Ingredient ID: NPC158306

Ingredient ID: NPC156654

Ingredient ID: NPC156457

Ingredient ID: NPC154599

Ingredient ID: NPC153502

Ingredient ID: NPC152538

Ingredient ID: NPC147086

Ingredient ID: NPC145708

Ingredient ID: NPC145112

Ingredient ID: NPC143326

Ingredient ID: NPC142860

Ingredient ID: NPC142754

Ingredient ID: NPC141078

Ingredient ID: NPC138374

Ingredient ID: NPC137949

Ingredient ID: NPC137816

Ingredient ID: NPC135846

Ingredient ID: NPC134909

Ingredient ID: NPC13444

Ingredient ID: NPC131624

Ingredient ID: NPC131207

Ingredient ID: NPC126004

Ingredient ID: NPC125062

Ingredient ID: NPC121270

Ingredient ID: NPC119441

Ingredient ID: NPC118378

Ingredient ID: NPC116841

Ingredient ID: NPC116775

Ingredient ID: NPC11232

Ingredient ID: NPC110942

Ingredient ID: NPC105095

Ingredient ID: NPC103728

Ingredient ID: NPC102449