• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Artemisia Pedemontana


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

TCGAACCCTGCAAAGCAGAACGACCCGCGAACACGTAAAAACAASCGAGCGTCGGTCGGATCAGGCGATCGCTTGATCCTCTCGACGCTTTGCCGATGCGCATTCGCTYGGGTTCTTTTGGACCCTGCGAGTGCGTCGTTGGCGCATTAACAACCCCCGGCACAATGTGTGCCAAGGAAAACTAAACTCGAGAAGGCTCGTTTCGTGTTGCACCCGTTCGCGGTGTGCTCATGGGACGCGGCTTCTTTATAATCACAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO20834
Plant Latin Name: Artemisia Pedemontana
Taxonomy Genus: Artemisia
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: 223869
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

16 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


7 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

8 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC94256

Ingredient ID: NPC66130

Ingredient ID: NPC51700

Ingredient ID: NPC306675

Ingredient ID: NPC287429

Ingredient ID: NPC254607

Ingredient ID: NPC245853

Ingredient ID: NPC243728

Ingredient ID: NPC243702

Ingredient ID: NPC236709

Ingredient ID: NPC230301

Ingredient ID: NPC195334

Ingredient ID: NPC1896

Ingredient ID: NPC175313

Ingredient ID: NPC13318

Ingredient ID: NPC109955