• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Mosla Dianthera


Example Image
PLANiTS DNA barcode

Click for details-----ITS

CCTGCAAAGCAGACCGCGAACACGTGTTTAACATCATCGGTCACGGTGTGGGGGAGACTCCCGCCGTGTGCCGCCCCCGTCCGGGCGCGCCCTCGGGCGTCGCCCCGTGCGGGCTAACGAACCCCGGCGCGGCAAGCGCCAAGGAAAACAAAATTTAGCGCCCGCCCTCCGCATCCCGTTCGCGGGGTGTGCGGGGGGTGTGGACGTCTATCGAATGTCATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCTCTCCCCGCGCCGAGCGCTCGTGAAGGGGGCGGATATTGGCCTCCCGTGCGCCCCGGCGTGCGGCTGGCCCAAATGAGATCCCTCGGCGACTCATGTCGCGACTGGTGGTGGTTGAATAACTCAATCTCGCGTCTTGTCGTGCTACTGCGTYGTTCGTACGGGCAGTGAATRATGACCCAACGGTGYTCGTGTGTTACAGCACCGCACCTTCGA

Click for details-----ITS1

NA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO20610
Plant Latin Name: Mosla Dianthera
Taxonomy Genus: Mosla
Taxonomy Family: Lamiaceae

Plant External Links:

NCBI TaxonomyDB: 1874238
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Thailand; Vietnam; Laos

Traditional Medicine System:


Medicinal Functions:

Carminative

Geographical Distribution

Thailand; Vietnam; Laos

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

10 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


9 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

8 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC95868

Ingredient ID: NPC88566

Ingredient ID: NPC76145

Ingredient ID: NPC68889

Ingredient ID: NPC34764

Ingredient ID: NPC297643

Ingredient ID: NPC283170

Ingredient ID: NPC20764

Ingredient ID: NPC203634

Ingredient ID: NPC187095