• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Psychotria Serpens


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAATCCTGCCTAGCAGACGACCGCGAACAAGTTGAAAATATCAAGGGTTGCATGCGGGCTTGGGAAACCTCGGCCGTCGGCGCCCTCAACGAACTAAACTCTCGGCGCGGAATGCGCCAAGGAATACTCAAAATGGATTGCCAGCATCTCTGCGGATTCCGCAGGGCTTGCTAGGCATCTTATCGGTTAACAAAAAGACTCTCGGCAACGGATATCTAGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGTCATTAGGCTGAGGGCACGTCTGTCTGGGCGTCACGCATCCAGTCGCCACCTCCCTCTCGACGTTAACGTTACGGAGGGGAGTGACGGATGTTGGCCTCCCGTGTCTCCGAGGCGCGGCTGGCCTAAATATGAGTCTTCGGCGCGAGACGTCACGACAAGTGGTGGTTGAACTCATCAACTCGTGTGCTGTCGCGACCACGCCTGACAGGGACTCCATCGACCCTAGAGCCCGGACTCGACAACAGATTGAGTTACGGACCTTCGA

Click for details-----ITS1

TCGAATCCTGCCTAGCAGACGACCGCGAACAAGTTGAAAATATCAAGGGTTGCATGCGGGCTTGGGAAACCTCGGCCGTCGGCGCCCTCAACGAACTAAACTCTCGGCGCGGAATGCGCCAAGGAATACTCAAAATGGATTGCCAGCATCTCTGCGGATTCCGCAGGGCTTGCTAGGCATCTTATCGGTTAACAAAA

Click for details-----ITS2

ATCCAGTCGCCACACCCCTCTCGACGTTAACGTTACGAAGGGGAGTGGCGGATATTGGCCTCCCGTGTCTCCGAGACGCGGCCGGCCTAAATCTGAGTCTTCGGCGCGAGACGTCGCGACAAGTGGTGGTTGAACTCATCAACTCGTGTGCTGTCGCGACCACGCCTGGCACGGACTCTKTCGACCCTAGAGCCCTAAACTCSNCGGAAAATTGAGTTATGGGCCTTCGACC
Taxonomic Information

Plant ID: NPO20569
Plant Latin Name: Psychotria Serpens
Taxonomy Genus: Psychotria
Taxonomy Family: Rubiaceae

Plant External Links:

NCBI TaxonomyDB: 77896
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM

Geographical Distribution

China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

94 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


41 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

32 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98106

Ingredient ID: NPC95866

Ingredient ID: NPC95083

Ingredient ID: NPC93953

Ingredient ID: NPC91493

Ingredient ID: NPC86856

Ingredient ID: NPC8659

Ingredient ID: NPC85813

Ingredient ID: NPC84324

Ingredient ID: NPC84255

Ingredient ID: NPC80690

Ingredient ID: NPC80286

Ingredient ID: NPC78263

Ingredient ID: NPC74604

Ingredient ID: NPC72406

Ingredient ID: NPC72077

Ingredient ID: NPC71106

Ingredient ID: NPC70936

Ingredient ID: NPC66618

Ingredient ID: NPC66087

Ingredient ID: NPC53292

Ingredient ID: NPC5319

Ingredient ID: NPC50898

Ingredient ID: NPC50775

Ingredient ID: NPC49975

Ingredient ID: NPC4713

Ingredient ID: NPC45479

Ingredient ID: NPC37250

Ingredient ID: NPC35704

Ingredient ID: NPC34544

Ingredient ID: NPC328788

Ingredient ID: NPC317

Ingredient ID: NPC311484

Ingredient ID: NPC311256

Ingredient ID: NPC304870

Ingredient ID: NPC304476

Ingredient ID: NPC303625

Ingredient ID: NPC303402

Ingredient ID: NPC301377

Ingredient ID: NPC300003

Ingredient ID: NPC299856

Ingredient ID: NPC289883

Ingredient ID: NPC288131

Ingredient ID: NPC281131

Ingredient ID: NPC279121

Ingredient ID: NPC278419

Ingredient ID: NPC273633

Ingredient ID: NPC273436

Ingredient ID: NPC263367

Ingredient ID: NPC262826

Ingredient ID: NPC251178

Ingredient ID: NPC244983

Ingredient ID: NPC244881

Ingredient ID: NPC243702

Ingredient ID: NPC242149

Ingredient ID: NPC240769

Ingredient ID: NPC239385

Ingredient ID: NPC238628

Ingredient ID: NPC232187

Ingredient ID: NPC229863

Ingredient ID: NPC22150

Ingredient ID: NPC221288

Ingredient ID: NPC219053

Ingredient ID: NPC218943

Ingredient ID: NPC20791

Ingredient ID: NPC206457

Ingredient ID: NPC200785

Ingredient ID: NPC199048

Ingredient ID: NPC196776

Ingredient ID: NPC194836

Ingredient ID: NPC193375

Ingredient ID: NPC188210

Ingredient ID: NPC173637

Ingredient ID: NPC172158

Ingredient ID: NPC167983

Ingredient ID: NPC1587

Ingredient ID: NPC145858

Ingredient ID: NPC145720

Ingredient ID: NPC131745

Ingredient ID: NPC13143

Ingredient ID: NPC130686

Ingredient ID: NPC128563

Ingredient ID: NPC126797

Ingredient ID: NPC126714

Ingredient ID: NPC123470

Ingredient ID: NPC12063

Ingredient ID: NPC120464

Ingredient ID: NPC118495

Ingredient ID: NPC116775

Ingredient ID: NPC113163

Ingredient ID: NPC111929

Ingredient ID: NPC106367

Ingredient ID: NPC104340

Ingredient ID: NPC101731