• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Bidens Pilosa


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GAAGGATCATTGTCGAACCCTGCAACAGCAGAACGACTCGTGAACATGTACTTAAACCTGGCATTGCGAGGACCGAAGCTCTTGTTTTGAGCCTCGTAAAGCCTTGTTGACCTGCGTTCATGGCCGTCCCTTGGGGCGTCCYGGATGTAGGTCGACACAACTAACAAWTCGGCACAAACCGTGCCAAGGAAAACATTACATAAAGGGCCCGTGCCATGTCGCCCCGTTTACGGCAAGCGCGTTGCACGTGGCCTCTTTGTAACCCTAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCGCCCCCACCATCCATCCCTTCAAGGGACATGTTGGTGTGGGGCGGAGATTGGTCTCCTGTGCCATGGCACGGTTGGCCTAAATAGAAGTCCCCTCATGAGTGACGCACGACTAGTGGTGGTTGATAAGACTGTCGTATCGTGTCGTGCGTTCGTTTCATGCGGGCTTGACTCCTTGTAAACCCACTTGTGTTGTCCTGTGACGATGCTTCGATCGCGACCCCA

Click for details-----ITS1

CATTGTCGACCCTGCACAGCAGAACGACTCGTGAACATGTACTTAAACCTGGCATTGCGAGGACCGAAGCTCTTGTTTTGAGCCTCGTAAAGCCTTGTTGACCTGCGTTCATGGCCGTCCCTTGGGGCGTCCTGGATGTAGGTCGACACAACTAACAAATCGGCACAAACCGTGCCAAGGAAAACATTACATAAAGGGCCCGTGCCATGTCGCCCCGTTTACGGCAAGCGCGTTGCACGTGGCCTCTTTGTAACCCTAAA

Click for details-----ITS2

ATCACGTCGCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGTTGGTGTGGGGCGGAGATTGGTCTCCTGTGCCATGGCACGGTTGGCCTAAATAGAAGTCCCCTCATGAGTGACGCACGACTAGTGGTGGTTGATAAGACTGTCGTATCGTGTCGTGCGTTCGTTTCATGCGGGCTTGACTCCTTGTAAACCCACTTGTGTTGTCCTGTGACGATGCTTCGA
Taxonomic Information

Plant ID: NPO20454
Plant Latin Name: Bidens Pilosa
Taxonomy Genus: Bidens
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: 42337
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Brazil; Madagascar; Indonesia; Angola; South Africa; Guinea; Tanzania; Mexico; India; Malaysia; Zimbabwe; Rwanda; Vietnam; Swaziland; Thailand; Kenya; Nigeria; Philippines

Traditional Medicine System:
Indian Folk


Medicinal Functions:

Alterative; Antifungal; Antiinflammatory; Antirheumatic; Styptic

Geographical Distribution

Brazil; Madagascar; Angola; Mexico; Guinea; Philippines; Indonesia; India; Zimbabwe; South Africa; Malaysia; Rwanda; Vietnam; Swaziland; Thailand; Kenya; Nigeria; Tanzania

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

81 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


40 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

22 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC97191

Ingredient ID: NPC95381

Ingredient ID: NPC90493

Ingredient ID: NPC88043

Ingredient ID: NPC87543

Ingredient ID: NPC85813

Ingredient ID: NPC73449

Ingredient ID: NPC62577

Ingredient ID: NPC58967

Ingredient ID: NPC55900

Ingredient ID: NPC50898

Ingredient ID: NPC49188

Ingredient ID: NPC41985

Ingredient ID: NPC38474

Ingredient ID: NPC3812

Ingredient ID: NPC34070

Ingredient ID: NPC33690

Ingredient ID: NPC33320

Ingredient ID: NPC311082

Ingredient ID: NPC307163

Ingredient ID: NPC306418

Ingredient ID: NPC302824

Ingredient ID: NPC301205

Ingredient ID: NPC300520

Ingredient ID: NPC294755

Ingredient ID: NPC294555

Ingredient ID: NPC294548

Ingredient ID: NPC291516

Ingredient ID: NPC288506

Ingredient ID: NPC28779

Ingredient ID: NPC279451

Ingredient ID: NPC279121

Ingredient ID: NPC272606

Ingredient ID: NPC268710

Ingredient ID: NPC262902

Ingredient ID: NPC260734

Ingredient ID: NPC25601

Ingredient ID: NPC249958

Ingredient ID: NPC247237

Ingredient ID: NPC244284

Ingredient ID: NPC244181

Ingredient ID: NPC239361

Ingredient ID: NPC237608

Ingredient ID: NPC236709

Ingredient ID: NPC234541

Ingredient ID: NPC227930

Ingredient ID: NPC217396

Ingredient ID: NPC217065

Ingredient ID: NPC21666

Ingredient ID: NPC206095

Ingredient ID: NPC204649

Ingredient ID: NPC189498

Ingredient ID: NPC189156

Ingredient ID: NPC185690

Ingredient ID: NPC184144

Ingredient ID: NPC181295

Ingredient ID: NPC181158

Ingredient ID: NPC177463

Ingredient ID: NPC177119

Ingredient ID: NPC176740

Ingredient ID: NPC169110

Ingredient ID: NPC161505

Ingredient ID: NPC154152

Ingredient ID: NPC152638

Ingredient ID: NPC145820

Ingredient ID: NPC140332

Ingredient ID: NPC139545

Ingredient ID: NPC134581

Ingredient ID: NPC133237

Ingredient ID: NPC129165

Ingredient ID: NPC129088

Ingredient ID: NPC125898

Ingredient ID: NPC123965

Ingredient ID: NPC118004

Ingredient ID: NPC116745

Ingredient ID: NPC115951

Ingredient ID: NPC112688

Ingredient ID: NPC108218

Ingredient ID: NPC107075

Ingredient ID: NPC10316

Ingredient ID: NPC101580