• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Chrysanthemum X Morifolium


Example Image
PLANiTS DNA barcode

Click for details-----ITS

CACACACAAAACGCAAAAGTCCCTATCAACCACTAAGTCTTGCCCCGGCTCGAGCTCGTGACTCCATGTGATCACGTGATCGAGTCGGGGAGAGCGCGAGAACACTGTAACATTGTCCCCAGAGGGGCCGCGATATGATGGTACCAAGTGCCCTCCTGCTGGCTGCTGGCCCCAGTCCAGTATGGAGGGTTGTGTGGGAAAATATGGTGGCCGCTCGCGGCATGCCACTGAGCACGGCGCTGATCACGTCGTGTTCGCCGCCACTGGGAGCACCGGCGGGCGTGGGCATGTCGCGGGAGGGGGACTCTTGCGCGGGCTCTCGTCATCTCAACGAGCCAGGGGGTCCAGCTAGCTAGCTAGCTAGCAATGGGGGACTTGGCTCCCACAGTCACCTTGGAGTGGCTGTGGGAGTCATGCGACCCAGCTGCTGCTGCTGGCTGGGTCCCTTGGTGGATGGCGACGCGGGAGTCTCCCCTCAAACTCCAACTCACGATTGCGCAATGCATCAACACTTTCCAATATGACTGAGCTTATCACTACAAAAGTGCACCATCCCCTTCCTCCTTCGGAGGGGGTGGGTGGTGCGCTTTGATGAGTTGTGAAACAAAATCAAACACAACTCTCAGCAACGGATATCTTGGCTCTTGCAACGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCCGTGAATCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCTGTCCTCGGGCATCTCTGCCTGAGCGTCATCGCGACACCCACCGTTCCACCACTTTGCTTCCCGAAGTGAAGTGAAGTGAAGTGGTGGACTGAGTGAAAGTGGCCGTCCGAACGAATGGGACGGCCCCCCTCCCACTTGTGGGGAGTGCGGGGTCGTCCAGACTCGAGTTGGGTTGGCTGAAATAGAGGGAATCCTACCGCCGTGGGGGGCACACTCCGCGCGATCAGGTGATCCAAGCCACTTTCTGAGTGGCTTGGAACTTAGCACGCGTGCGAGTGTGTCTCCCGGAAGGACATCCAAAGCAGGTCTTTTTTGCCCCCTTCGAAAGAGGGGGGCAAAAAACAAGGTCACGC

Click for details-----ITS1

GGCGACGACGGGGATTCTAATAAATTCTTATCCTTATCATTAAGGAAGGAGAGTCGTACAAGTTTCCGTAGGTGAACTGCGAAGGATCATTGCACACCCAAACTGCAAAGAAGCCAACCCAAACTGGGTCCGGTCTCTCGTGGCGCTCCTCGGGGGGCGCTGCGGGTGCCGGACTCTCTGAGAATGCGAGTTTTACCTTCGAACATTCTGAAGCTCTTCGGGTGGCTGCCGAGCGCTCCTCCGGGTGCGCCCCCTACTTGGGACGTCCTCCTCCTCTTCAAGGCTGCATTCAGCTCCTCAGCCTGTCGCCCCCGGCCGGAACTTTGGCTCGCGGTGCTCGGTCTAGGCCGAATCCACTTAGCGGTCACGGGACTGGATCCGGGATTAGWACCGGCAGGCGGGGAGTGCTACCGCGGGAGGGCTAGGGAGGGTCCCMGCCGCCCCCAAGTGAAGTGCGTACCCGAAACTCTGSARGAGTTTTGCGAGGCASTGCTCGTTAGGAKTGGAAACCCCGAATGAAAAATTATTTCCAAAGTCCCCAAGACTGAGGACCCTTATTTTGACCCGAGAGTTTGAGCCCACTTCCGAGTGGGGGACTCGAACACACGAGTTGTGAATCTAATCTAACTTAGAA

Click for details-----ITS2

CATCGTCGCCTTTGCTCCTTGCTTTGCCGGTGGAAGTTGCCTTTTCCCGGGCGGTCGACACTAGGGACAAGAACTCCGAACAGAAGGCCCTTCGACGTGCGCGGGGGAGCCCAATGCGTCCTAAACTCTTCGAAACAATGACTCTTGGCAATGGAATTCTTGGGTCTTGCCTTCATTAACAACGTAATGAAATGCAATACTTTGGTGTGAATTGGATAAATTCCGGAACCAATTAATCTTTTAACCCAAGTTTGGCCCGAGGCCTTTTGGCCGAGGGGCCCCCTGCTTGGGCCGTCATGGCATTCTTCCCTTTTGGCTCCCCTGGTTGGTTGGGCCGCCGAACGGAAAATTTGGGATTCTGTGGTTTTCCTCCGTTCCACAGTTTTGGGTCGAAAAAAAGTGGGGTTAAGTCTCGGTCTGCTTCC
Taxonomic Information

Plant ID: NPO20440
Plant Latin Name: Chrysanthemum X Morifolium
Taxonomy Genus: Chrysanthemum
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: 41568
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Thailand

Traditional Medicine System:
Kampo

Geographical Distribution

Thailand

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

556 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


422 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

206 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99480

Ingredient ID: NPC9880

Ingredient ID: NPC98246

Ingredient ID: NPC98194

Ingredient ID: NPC96630

Ingredient ID: NPC95675

Ingredient ID: NPC95581

Ingredient ID: NPC95392

Ingredient ID: NPC95090

Ingredient ID: NPC95031

Ingredient ID: NPC9424

Ingredient ID: NPC93912

Ingredient ID: NPC93843

Ingredient ID: NPC92774

Ingredient ID: NPC92197

Ingredient ID: NPC91574

Ingredient ID: NPC90803

Ingredient ID: NPC90506

Ingredient ID: NPC90232

Ingredient ID: NPC90105

Ingredient ID: NPC8959

Ingredient ID: NPC89069

Ingredient ID: NPC88566

Ingredient ID: NPC88325

Ingredient ID: NPC87828

Ingredient ID: NPC87717

Ingredient ID: NPC87152

Ingredient ID: NPC86941

Ingredient ID: NPC86683

Ingredient ID: NPC86598

Ingredient ID: NPC8633

Ingredient ID: NPC85810

Ingredient ID: NPC85665

Ingredient ID: NPC85550

Ingredient ID: NPC85473

Ingredient ID: NPC85248

Ingredient ID: NPC85105

Ingredient ID: NPC84793

Ingredient ID: NPC84226

Ingredient ID: NPC84211

Ingredient ID: NPC83470

Ingredient ID: NPC83187

Ingredient ID: NPC82648

Ingredient ID: NPC82399

Ingredient ID: NPC81775

Ingredient ID: NPC8120

Ingredient ID: NPC80090

Ingredient ID: NPC79943

Ingredient ID: NPC79457

Ingredient ID: NPC79273

Ingredient ID: NPC7913

Ingredient ID: NPC79056

Ingredient ID: NPC78551

Ingredient ID: NPC78500

Ingredient ID: NPC76817

Ingredient ID: NPC7639

Ingredient ID: NPC76145

Ingredient ID: NPC75158

Ingredient ID: NPC7491

Ingredient ID: NPC71703

Ingredient ID: NPC71613

Ingredient ID: NPC71531

Ingredient ID: NPC71506

Ingredient ID: NPC70744

Ingredient ID: NPC68889

Ingredient ID: NPC67986

Ingredient ID: NPC67731

Ingredient ID: NPC66577

Ingredient ID: NPC66145

Ingredient ID: NPC65711

Ingredient ID: NPC65003

Ingredient ID: NPC64866

Ingredient ID: NPC64176

Ingredient ID: NPC64051

Ingredient ID: NPC62086

Ingredient ID: NPC60801

Ingredient ID: NPC60556

Ingredient ID: NPC60288

Ingredient ID: NPC5946

Ingredient ID: NPC59356

Ingredient ID: NPC59002

Ingredient ID: NPC58970

Ingredient ID: NPC57877

Ingredient ID: NPC57234

Ingredient ID: NPC56365

Ingredient ID: NPC55903

Ingredient ID: NPC55830

Ingredient ID: NPC55740

Ingredient ID: NPC55715

Ingredient ID: NPC55483

Ingredient ID: NPC54264

Ingredient ID: NPC54087

Ingredient ID: NPC52230

Ingredient ID: NPC52005

Ingredient ID: NPC51758

Ingredient ID: NPC51257

Ingredient ID: NPC51189

Ingredient ID: NPC50898

Ingredient ID: NPC50786

Ingredient ID: NPC50450

Ingredient ID: NPC488323

Ingredient ID: NPC488322

Ingredient ID: NPC488321

Ingredient ID: NPC488320

Ingredient ID: NPC488319

Ingredient ID: NPC47608

Ingredient ID: NPC47255

Ingredient ID: NPC46705

Ingredient ID: NPC46202

Ingredient ID: NPC45727

Ingredient ID: NPC44931

Ingredient ID: NPC44751

Ingredient ID: NPC44671

Ingredient ID: NPC44328

Ingredient ID: NPC44210

Ingredient ID: NPC43763

Ingredient ID: NPC43728

Ingredient ID: NPC43565

Ingredient ID: NPC43264

Ingredient ID: NPC43114

Ingredient ID: NPC41385

Ingredient ID: NPC41180

Ingredient ID: NPC41004

Ingredient ID: NPC40249

Ingredient ID: NPC39620

Ingredient ID: NPC3941

Ingredient ID: NPC39360

Ingredient ID: NPC38751

Ingredient ID: NPC37871

Ingredient ID: NPC37331

Ingredient ID: NPC3649

Ingredient ID: NPC36408

Ingredient ID: NPC35943

Ingredient ID: NPC35519

Ingredient ID: NPC34764

Ingredient ID: NPC34440

Ingredient ID: NPC34103

Ingredient ID: NPC3389

Ingredient ID: NPC32441

Ingredient ID: NPC32222

Ingredient ID: NPC31789

Ingredient ID: NPC3155

Ingredient ID: NPC311485

Ingredient ID: NPC310073

Ingredient ID: NPC309355

Ingredient ID: NPC309182

Ingredient ID: NPC30853

Ingredient ID: NPC308218

Ingredient ID: NPC308108

Ingredient ID: NPC307216

Ingredient ID: NPC307063

Ingredient ID: NPC307011

Ingredient ID: NPC306990

Ingredient ID: NPC306375

Ingredient ID: NPC306302

Ingredient ID: NPC305327

Ingredient ID: NPC304541

Ingredient ID: NPC30433

Ingredient ID: NPC30430

Ingredient ID: NPC303305

Ingredient ID: NPC303090

Ingredient ID: NPC302857

Ingredient ID: NPC302327

Ingredient ID: NPC301771

Ingredient ID: NPC301585

Ingredient ID: NPC301388

Ingredient ID: NPC301181

Ingredient ID: NPC300649

Ingredient ID: NPC300647

Ingredient ID: NPC299069

Ingredient ID: NPC29883

Ingredient ID: NPC298797

Ingredient ID: NPC297844

Ingredient ID: NPC297746

Ingredient ID: NPC297632

Ingredient ID: NPC297527

Ingredient ID: NPC297517

Ingredient ID: NPC297186

Ingredient ID: NPC29710

Ingredient ID: NPC29680

Ingredient ID: NPC296337

Ingredient ID: NPC296251

Ingredient ID: NPC294902

Ingredient ID: NPC294548

Ingredient ID: NPC294136

Ingredient ID: NPC294134

Ingredient ID: NPC293979

Ingredient ID: NPC292419

Ingredient ID: NPC291588

Ingredient ID: NPC291539

Ingredient ID: NPC291226

Ingredient ID: NPC290189

Ingredient ID: NPC290082

Ingredient ID: NPC290078

Ingredient ID: NPC289366

Ingredient ID: NPC288991

Ingredient ID: NPC288932

Ingredient ID: NPC287731

Ingredient ID: NPC287660

Ingredient ID: NPC287335

Ingredient ID: NPC287331

Ingredient ID: NPC287063

Ingredient ID: NPC286931

Ingredient ID: NPC286774

Ingredient ID: NPC286695

Ingredient ID: NPC285814

Ingredient ID: NPC284948

Ingredient ID: NPC284731

Ingredient ID: NPC284174

Ingredient ID: NPC284034

Ingredient ID: NPC283655

Ingredient ID: NPC283388

Ingredient ID: NPC282838

Ingredient ID: NPC282694

Ingredient ID: NPC281213

Ingredient ID: NPC281131

Ingredient ID: NPC279508

Ingredient ID: NPC279481

Ingredient ID: NPC279404

Ingredient ID: NPC279364

Ingredient ID: NPC279121

Ingredient ID: NPC279026

Ingredient ID: NPC278683

Ingredient ID: NPC278417

Ingredient ID: NPC278399

Ingredient ID: NPC278068

Ingredient ID: NPC277736

Ingredient ID: NPC277565

Ingredient ID: NPC27699

Ingredient ID: NPC27408

Ingredient ID: NPC274075

Ingredient ID: NPC273607

Ingredient ID: NPC273385

Ingredient ID: NPC272902

Ingredient ID: NPC272765

Ingredient ID: NPC27184

Ingredient ID: NPC271559

Ingredient ID: NPC271087

Ingredient ID: NPC271042

Ingredient ID: NPC270641

Ingredient ID: NPC26960

Ingredient ID: NPC26906

Ingredient ID: NPC268862

Ingredient ID: NPC266693

Ingredient ID: NPC266603

Ingredient ID: NPC265407

Ingredient ID: NPC263767

Ingredient ID: NPC262789

Ingredient ID: NPC261080

Ingredient ID: NPC260976

Ingredient ID: NPC260381

Ingredient ID: NPC259725

Ingredient ID: NPC259512

Ingredient ID: NPC259118

Ingredient ID: NPC258219

Ingredient ID: NPC256848

Ingredient ID: NPC255350

Ingredient ID: NPC255039

Ingredient ID: NPC254713

Ingredient ID: NPC254156

Ingredient ID: NPC253484

Ingredient ID: NPC252230

Ingredient ID: NPC252067

Ingredient ID: NPC252009

Ingredient ID: NPC250754

Ingredient ID: NPC250409

Ingredient ID: NPC249880

Ingredient ID: NPC249815

Ingredient ID: NPC249347

Ingredient ID: NPC249009

Ingredient ID: NPC248726

Ingredient ID: NPC248411

Ingredient ID: NPC248235

Ingredient ID: NPC247266

Ingredient ID: NPC247030

Ingredient ID: NPC246544

Ingredient ID: NPC246543

Ingredient ID: NPC246165

Ingredient ID: NPC246125

Ingredient ID: NPC245789

Ingredient ID: NPC243898

Ingredient ID: NPC243351

Ingredient ID: NPC24294

Ingredient ID: NPC242641

Ingredient ID: NPC242314

Ingredient ID: NPC24146

Ingredient ID: NPC241110

Ingredient ID: NPC240899

Ingredient ID: NPC240817

Ingredient ID: NPC239039

Ingredient ID: NPC239037

Ingredient ID: NPC238960

Ingredient ID: NPC238475

Ingredient ID: NPC23801

Ingredient ID: NPC236579

Ingredient ID: NPC236043

Ingredient ID: NPC234231

Ingredient ID: NPC234133

Ingredient ID: NPC233533

Ingredient ID: NPC232375

Ingredient ID: NPC232106

Ingredient ID: NPC231773

Ingredient ID: NPC231772

Ingredient ID: NPC231738

Ingredient ID: NPC23167

Ingredient ID: NPC231457

Ingredient ID: NPC23145

Ingredient ID: NPC231420

Ingredient ID: NPC230291

Ingredient ID: NPC230070

Ingredient ID: NPC229782

Ingredient ID: NPC229409

Ingredient ID: NPC229403

Ingredient ID: NPC22832

Ingredient ID: NPC228074

Ingredient ID: NPC227670

Ingredient ID: NPC22760

Ingredient ID: NPC227378

Ingredient ID: NPC225880

Ingredient ID: NPC225463

Ingredient ID: NPC22484

Ingredient ID: NPC224389

Ingredient ID: NPC223848

Ingredient ID: NPC223549

Ingredient ID: NPC223455

Ingredient ID: NPC22229

Ingredient ID: NPC222001

Ingredient ID: NPC22162

Ingredient ID: NPC220860

Ingredient ID: NPC220825

Ingredient ID: NPC220074

Ingredient ID: NPC219510

Ingredient ID: NPC219443

Ingredient ID: NPC218918

Ingredient ID: NPC216630

Ingredient ID: NPC216341

Ingredient ID: NPC216330

Ingredient ID: NPC215632

Ingredient ID: NPC214909

Ingredient ID: NPC214609

Ingredient ID: NPC214591

Ingredient ID: NPC214584

Ingredient ID: NPC213935

Ingredient ID: NPC213842

Ingredient ID: NPC213749

Ingredient ID: NPC213500

Ingredient ID: NPC21266

Ingredient ID: NPC212208

Ingredient ID: NPC210831

Ingredient ID: NPC21038

Ingredient ID: NPC210040

Ingredient ID: NPC210003

Ingredient ID: NPC209431

Ingredient ID: NPC209296

Ingredient ID: NPC209275

Ingredient ID: NPC208936

Ingredient ID: NPC208764

Ingredient ID: NPC208151

Ingredient ID: NPC208075

Ingredient ID: NPC20791

Ingredient ID: NPC207844

Ingredient ID: NPC20742

Ingredient ID: NPC206095

Ingredient ID: NPC205865

Ingredient ID: NPC20505

Ingredient ID: NPC204596

Ingredient ID: NPC20410

Ingredient ID: NPC203686

Ingredient ID: NPC20363

Ingredient ID: NPC203144

Ingredient ID: NPC203050

Ingredient ID: NPC202189

Ingredient ID: NPC201562

Ingredient ID: NPC200459

Ingredient ID: NPC200184

Ingredient ID: NPC198658

Ingredient ID: NPC197994

Ingredient ID: NPC197942

Ingredient ID: NPC197571

Ingredient ID: NPC196490

Ingredient ID: NPC194939

Ingredient ID: NPC194774

Ingredient ID: NPC19319

Ingredient ID: NPC193180

Ingredient ID: NPC19241

Ingredient ID: NPC190814

Ingredient ID: NPC190180

Ingredient ID: NPC189853

Ingredient ID: NPC189142

Ingredient ID: NPC189036

Ingredient ID: NPC188238

Ingredient ID: NPC187979

Ingredient ID: NPC187796

Ingredient ID: NPC18772

Ingredient ID: NPC18607

Ingredient ID: NPC185878

Ingredient ID: NPC185497

Ingredient ID: NPC184049

Ingredient ID: NPC183670

Ingredient ID: NPC18335

Ingredient ID: NPC182522

Ingredient ID: NPC182315

Ingredient ID: NPC182164

Ingredient ID: NPC182158

Ingredient ID: NPC182102

Ingredient ID: NPC180871

Ingredient ID: NPC180684

Ingredient ID: NPC180398

Ingredient ID: NPC179950

Ingredient ID: NPC179024

Ingredient ID: NPC178676

Ingredient ID: NPC178565

Ingredient ID: NPC178223

Ingredient ID: NPC178140

Ingredient ID: NPC177112

Ingredient ID: NPC176819

Ingredient ID: NPC176740

Ingredient ID: NPC176589

Ingredient ID: NPC176270

Ingredient ID: NPC176039

Ingredient ID: NPC175987

Ingredient ID: NPC175913

Ingredient ID: NPC174167

Ingredient ID: NPC173996

Ingredient ID: NPC173760

Ingredient ID: NPC173637

Ingredient ID: NPC173228

Ingredient ID: NPC171145

Ingredient ID: NPC170799

Ingredient ID: NPC168714

Ingredient ID: NPC168579

Ingredient ID: NPC168058

Ingredient ID: NPC167976

Ingredient ID: NPC16728

Ingredient ID: NPC166894

Ingredient ID: NPC166362

Ingredient ID: NPC166303

Ingredient ID: NPC1656

Ingredient ID: NPC165159

Ingredient ID: NPC164741

Ingredient ID: NPC164614

Ingredient ID: NPC163984

Ingredient ID: NPC162866

Ingredient ID: NPC161617

Ingredient ID: NPC16157

Ingredient ID: NPC160951

Ingredient ID: NPC16070

Ingredient ID: NPC158537

Ingredient ID: NPC157781

Ingredient ID: NPC157764

Ingredient ID: NPC157503

Ingredient ID: NPC156654

Ingredient ID: NPC156486

Ingredient ID: NPC155182

Ingredient ID: NPC154650

Ingredient ID: NPC154493

Ingredient ID: NPC154316

Ingredient ID: NPC154186

Ingredient ID: NPC154003

Ingredient ID: NPC153958

Ingredient ID: NPC153572

Ingredient ID: NPC15336

Ingredient ID: NPC152964

Ingredient ID: NPC152438

Ingredient ID: NPC150919

Ingredient ID: NPC150329

Ingredient ID: NPC149550

Ingredient ID: NPC14949

Ingredient ID: NPC149060

Ingredient ID: NPC148303

Ingredient ID: NPC14682

Ingredient ID: NPC146682

Ingredient ID: NPC14608

Ingredient ID: NPC14576

Ingredient ID: NPC144707

Ingredient ID: NPC144595

Ingredient ID: NPC14426

Ingredient ID: NPC144023

Ingredient ID: NPC143639

Ingredient ID: NPC142703

Ingredient ID: NPC142265

Ingredient ID: NPC141777

Ingredient ID: NPC141765

Ingredient ID: NPC141273

Ingredient ID: NPC14079

Ingredient ID: NPC13991

Ingredient ID: NPC139557

Ingredient ID: NPC139546

Ingredient ID: NPC138811

Ingredient ID: NPC138347

Ingredient ID: NPC138113

Ingredient ID: NPC13789

Ingredient ID: NPC136534

Ingredient ID: NPC136184

Ingredient ID: NPC135238

Ingredient ID: NPC134291

Ingredient ID: NPC13428

Ingredient ID: NPC13237

Ingredient ID: NPC131981

Ingredient ID: NPC131769

Ingredient ID: NPC131482

Ingredient ID: NPC130683

Ingredient ID: NPC12845

Ingredient ID: NPC128007

Ingredient ID: NPC12664

Ingredient ID: NPC126580

Ingredient ID: NPC126240

Ingredient ID: NPC125687

Ingredient ID: NPC125275

Ingredient ID: NPC125191

Ingredient ID: NPC125144

Ingredient ID: NPC125062

Ingredient ID: NPC124877

Ingredient ID: NPC124876

Ingredient ID: NPC124323

Ingredient ID: NPC12269

Ingredient ID: NPC122467

Ingredient ID: NPC121875

Ingredient ID: NPC121373

Ingredient ID: NPC121322

Ingredient ID: NPC120926

Ingredient ID: NPC120464

Ingredient ID: NPC120258

Ingredient ID: NPC12013

Ingredient ID: NPC120015

Ingredient ID: NPC119267

Ingredient ID: NPC11905

Ingredient ID: NPC118343

Ingredient ID: NPC117493

Ingredient ID: NPC116996

Ingredient ID: NPC116775

Ingredient ID: NPC115993

Ingredient ID: NPC115937

Ingredient ID: NPC115674

Ingredient ID: NPC114992

Ingredient ID: NPC114764

Ingredient ID: NPC114239

Ingredient ID: NPC111888

Ingredient ID: NPC111402

Ingredient ID: NPC110939

Ingredient ID: NPC110061

Ingredient ID: NPC109813

Ingredient ID: NPC107540

Ingredient ID: NPC1075

Ingredient ID: NPC106250

Ingredient ID: NPC105557

Ingredient ID: NPC105509

Ingredient ID: NPC104631

Ingredient ID: NPC103213

Ingredient ID: NPC102091

Ingredient ID: NPC10187

Ingredient ID: NPC101285

Ingredient ID: NPC100809

Ingredient ID: NPC100570

Ingredient ID: NPC100502

Ingredient ID: NPC100445