• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Ocimum Basilicum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

AATTATTAAAACCACAATGCGAACCTATCTGTTCCGTGCCTTAGCTGCCAGCAAGGCAATTGGCTTGCCCAATTGTACTTGCAAGCTGGTGCGAGTAATTTGATTACTTGCATCAGTGGCGCTTTGGCATGCTTATACACCAGTGCTAACCACTGTCAAAACCAAACTCTGAAGCTTTGATTGCTATTAACTGGCAATCTTAACCAAAGACAACTCTCAACAACGGATATCTTGGCTCTCGCAACGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCCGTGAACCATCGAATCTTTGAACGCATATTGCGCTCGAGCCCTCGGGCAAGAGCATGTCTGCCTCAGCGTCGGTTTACACCCTCACCCCTCTTCCTTAACAGGAGGCGCCTGTCGTGCTTGCTTAAGCCGGCAGCAGGGGTGGATCTGGCTCTCCCAATCGGATTCACTCTGGTTGGGTTGGCTGAAGCACAGAGGCTTAAACTGGGACCCAATTCGGGCTCAACTGGATAGGTAGCAACACCCTCGGGTGCCTACACGAAGTTGTGTCTGAGGACCTGGTTAGGAGCCAAGCAGGAAACGCGTCTCTGGCGCGTACTCTGTATTCGACCTGAGCTCAGGCAAGGCTA

Click for details-----ITS1

GGGGCCCCAGCGGAGACTTGTCGAACCCTGCTCAAGCAGAACGACCCGCGAACACGTGAAAACAACCATGCTGGGGACCGGAGAGGGGTGCGAGCCCCCGACCGACCCTCCGCCGTGCTGCGGATCCGGCCGCGTGCGGTCGACCGCGGTACGGCACAATCAAAAAACCCGGCGCAACAGGCGTCAAGGAAATCTTAGCGGAAACGAGGCGGAGTCCCGCTCGCGGGGCGATGCCAAGAATCCGATACCTGAA

Click for details-----ITS2

ATCGCGTCGCCCCCCCATCCCCGCGCACCGCGCTCGGCTTGGGGGGGCGGATACTGGCCTCCCGTGCGCCCCGCCGCGCGGCCGGCCCAAATGCGATCCCCCGGCGACCCGCGTCGCGACAAGTGGTGGTTGAACTCTTCAATTTCCCCGTCGCGCCCCGTATCGTCCGTGCGGATTCCTTTGGAAACCAACCCACCTCCATCGCCAGCCACGGCCGGGCGGGATCACCCGCTGAGTTAAT
Taxonomic Information

Plant ID: NPO20414
Plant Latin Name: Ocimum Basilicum
Taxonomy Genus: Ocimum
Taxonomy Family: Lamiaceae

Plant External Links:

NCBI TaxonomyDB: 39350
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Brazil; Israel; Italy; Mexico; Lebanon; Tanzania; Indonesia; India; Rwanda; Jordan; China; Thailand; Switzerland; Kenya; Argentina; Philippines; Nigeria

Traditional Medicine System:
Sowa-Rigpa; Indian Folk; Unani; Siddha; Ayurveda; TCM; Homeopathy


Medicinal Functions:

Antibacterial; Antidepressant; Antirheumatic; Antispasmodic; Appetizer; Aromatherapy; Aromatic; Carminative; Digestive; Galactogogue; Ophthalmic; Stomachic; Tonic

Geographical Distribution

Brazil; Israel; Italy; Mexico; Lebanon; Philippines; Indonesia; India; Rwanda; China; Kenya; Switzerland; Jordan; Argentina; Tanzania; Nigeria; Thailand

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

177 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


144 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

109 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99886

Ingredient ID: NPC99734

Ingredient ID: NPC99088

Ingredient ID: NPC96927

Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC91989

Ingredient ID: NPC88566

Ingredient ID: NPC87828

Ingredient ID: NPC85488

Ingredient ID: NPC83181

Ingredient ID: NPC83088

Ingredient ID: NPC81010

Ingredient ID: NPC79765

Ingredient ID: NPC79576

Ingredient ID: NPC78551

Ingredient ID: NPC71853

Ingredient ID: NPC70744

Ingredient ID: NPC69875

Ingredient ID: NPC68779

Ingredient ID: NPC67761

Ingredient ID: NPC66704

Ingredient ID: NPC65295

Ingredient ID: NPC64176

Ingredient ID: NPC62045

Ingredient ID: NPC61

Ingredient ID: NPC60151

Ingredient ID: NPC59650

Ingredient ID: NPC58616

Ingredient ID: NPC55586

Ingredient ID: NPC55412

Ingredient ID: NPC5413

Ingredient ID: NPC51700

Ingredient ID: NPC490427

Ingredient ID: NPC490424

Ingredient ID: NPC490309

Ingredient ID: NPC490308

Ingredient ID: NPC490148

Ingredient ID: NPC490047

Ingredient ID: NPC489926

Ingredient ID: NPC489907

Ingredient ID: NPC48623

Ingredient ID: NPC469006

Ingredient ID: NPC46223

Ingredient ID: NPC45270

Ingredient ID: NPC39927

Ingredient ID: NPC38522

Ingredient ID: NPC37931

Ingredient ID: NPC37468

Ingredient ID: NPC3672

Ingredient ID: NPC36680

Ingredient ID: NPC3649

Ingredient ID: NPC36108

Ingredient ID: NPC34764

Ingredient ID: NPC328447

Ingredient ID: NPC317120

Ingredient ID: NPC313955

Ingredient ID: NPC313163

Ingredient ID: NPC312800

Ingredient ID: NPC31279

Ingredient ID: NPC311988

Ingredient ID: NPC29883

Ingredient ID: NPC294902

Ingredient ID: NPC294548

Ingredient ID: NPC292792

Ingredient ID: NPC291100

Ingredient ID: NPC287331

Ingredient ID: NPC286774

Ingredient ID: NPC281686

Ingredient ID: NPC279865

Ingredient ID: NPC274327

Ingredient ID: NPC272614

Ingredient ID: NPC27186

Ingredient ID: NPC271803

Ingredient ID: NPC269980

Ingredient ID: NPC269919

Ingredient ID: NPC26906

Ingredient ID: NPC2660

Ingredient ID: NPC265305

Ingredient ID: NPC259512

Ingredient ID: NPC259134

Ingredient ID: NPC258767

Ingredient ID: NPC258672

Ingredient ID: NPC257625

Ingredient ID: NPC257124

Ingredient ID: NPC255430

Ingredient ID: NPC255042

Ingredient ID: NPC252222

Ingredient ID: NPC2517

Ingredient ID: NPC251407

Ingredient ID: NPC24824

Ingredient ID: NPC246165

Ingredient ID: NPC24327

Ingredient ID: NPC242580

Ingredient ID: NPC237812

Ingredient ID: NPC235901

Ingredient ID: NPC231324

Ingredient ID: NPC231018

Ingredient ID: NPC230301

Ingredient ID: NPC229262

Ingredient ID: NPC228980

Ingredient ID: NPC228342

Ingredient ID: NPC226453

Ingredient ID: NPC226027

Ingredient ID: NPC222001

Ingredient ID: NPC219143

Ingredient ID: NPC217590

Ingredient ID: NPC217226

Ingredient ID: NPC217052

Ingredient ID: NPC215012

Ingredient ID: NPC214805

Ingredient ID: NPC213876

Ingredient ID: NPC213749

Ingredient ID: NPC208793

Ingredient ID: NPC203468

Ingredient ID: NPC202189

Ingredient ID: NPC199610

Ingredient ID: NPC198658

Ingredient ID: NPC197396

Ingredient ID: NPC190771

Ingredient ID: NPC187770

Ingredient ID: NPC185755

Ingredient ID: NPC182840

Ingredient ID: NPC18205

Ingredient ID: NPC181228

Ingredient ID: NPC180871

Ingredient ID: NPC17810

Ingredient ID: NPC177112

Ingredient ID: NPC17647

Ingredient ID: NPC176309

Ingredient ID: NPC176017

Ingredient ID: NPC175987

Ingredient ID: NPC175313

Ingredient ID: NPC174246

Ingredient ID: NPC173996

Ingredient ID: NPC171385

Ingredient ID: NPC1682

Ingredient ID: NPC167400

Ingredient ID: NPC166894

Ingredient ID: NPC166362

Ingredient ID: NPC164487

Ingredient ID: NPC15912

Ingredient ID: NPC155182

Ingredient ID: NPC152451

Ingredient ID: NPC151620

Ingredient ID: NPC150950

Ingredient ID: NPC150713

Ingredient ID: NPC150413

Ingredient ID: NPC149803

Ingredient ID: NPC14930

Ingredient ID: NPC147983

Ingredient ID: NPC142415

Ingredient ID: NPC139134

Ingredient ID: NPC138113

Ingredient ID: NPC137958

Ingredient ID: NPC13755

Ingredient ID: NPC136014

Ingredient ID: NPC130683

Ingredient ID: NPC126681

Ingredient ID: NPC126027

Ingredient ID: NPC122767

Ingredient ID: NPC121373

Ingredient ID: NPC120926

Ingredient ID: NPC117930

Ingredient ID: NPC116707

Ingredient ID: NPC11433

Ingredient ID: NPC114011

Ingredient ID: NPC112890

Ingredient ID: NPC112701

Ingredient ID: NPC112439

Ingredient ID: NPC111888

Ingredient ID: NPC110126

Ingredient ID: NPC109736

Ingredient ID: NPC109516

Ingredient ID: NPC108218

Ingredient ID: NPC105246

Ingredient ID: NPC101593