• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Arnebia Guttata


Example Image
PLANiTS DNA barcode

Click for details-----ITS

ACGGCATAGTCTTGTCGATCTGCACAGCAGACCACCCGCGAACAAGTTCTAAAAACCAAGGCACCGGTCGGTGCAAGGAATACCTTGCTCTCGATCGGAGCCCAACGGTGCCACGGCATCTTGTCGTGGCGCTGAACAAACCCCCGGCGCGAGAAGCGCCAAGGAATACTTTAACGAGAGCTTGAACCTTCCTCTCCCGTTCGCGGGGTTTAGGGGTTGGAAAACGGTTTCTTTATAAACCACACCAACTCTCGGCAACGAATATCTGGCTTCTCGCATCAATAAGAACCGTACCGAATTGCAATACTGGTGGTGAATTGCAAATTCCCGGGAACCATCAAGTCTTTGAACGCAGGTGGCGCCTGAGGCCATTAGGTTAAAGGAACGTCTGCTTGGCCGTCACACTTCGCGTCACCCCATCCAAAATATTGTTGAATGTGTGGAATGGTGACTTCCTGTGTCTGGAGATGCAGTTGGTCAAAATTCAAGTCCGAAGCTAAGAACTCCACGACAAGTGTTGGTTGAATACACCTCGCGTCATGTTGTGTGCCAAACTCTCCGTGCTCCGTAGACCCTAAGGCGCGTGCTTTCCACCTCGTTCGTTGGAAAACCGTGCTACAA

Click for details-----ITS1

ACGGCATAGTCTTGTCGATCTGCACAGCAGACCACCCGCGAACAAGTTCTAAAAACCAAGGCACCGGTCGGTGCAAGGAATACCTTGCTCTCGATCGGAGCCCAACGGTGCCACGGCATCTTGTCGTGGCGCTGAACAAACCCCCGGCGCGAGAAGCGCCAAGGAATACTTTAACGAGAGCTTGAACCTTCCTCTCCCGTTCGCGGGGTTTAGGGGTTGGAAAACGGTTTCTTTATAAACCACAC

Click for details-----ITS2

CTTGCGTCATTCTTCCCATCCATCTTTGGTTAACATAGTATGGGTGGCGATGGATGTGGAGATTGACCCTCCGTTCTTTAGTGGTGCGGTTGGTTTAAGGGAATGTTGTCGCTAGGTCCATGCACGGCGAATGGAGTATCGAGGTAACGAAGATGTTTCTAGCTGCGTTTAGGATTCCTAAGTGCGACGTAACGTTAACTGAAACCATTCTCGATGTTTGCATAAGTCGCAAACTCGAA
Taxonomic Information

Plant ID: NPO20297
Plant Latin Name: Arnebia Guttata
Taxonomy Genus: Arnebia
Taxonomy Family: Boraginaceae

Plant External Links:

NCBI TaxonomyDB: 419289
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China; India

Traditional Medicine System:
Indian Folk; TCM

Geographical Distribution

India; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

136 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


105 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

72 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99886

Ingredient ID: NPC99244

Ingredient ID: NPC96835

Ingredient ID: NPC96630

Ingredient ID: NPC95952

Ingredient ID: NPC89069

Ingredient ID: NPC88566

Ingredient ID: NPC87517

Ingredient ID: NPC87299

Ingredient ID: NPC86062

Ingredient ID: NPC85123

Ingredient ID: NPC83743

Ingredient ID: NPC75158

Ingredient ID: NPC7491

Ingredient ID: NPC72695

Ingredient ID: NPC71823

Ingredient ID: NPC68752

Ingredient ID: NPC64022

Ingredient ID: NPC61066

Ingredient ID: NPC61

Ingredient ID: NPC59581

Ingredient ID: NPC59101

Ingredient ID: NPC58478

Ingredient ID: NPC54980

Ingredient ID: NPC54264

Ingredient ID: NPC49151

Ingredient ID: NPC47489

Ingredient ID: NPC44751

Ingredient ID: NPC42471

Ingredient ID: NPC40249

Ingredient ID: NPC39633

Ingredient ID: NPC327916

Ingredient ID: NPC32749

Ingredient ID: NPC313170

Ingredient ID: NPC309606

Ingredient ID: NPC309339

Ingredient ID: NPC308218

Ingredient ID: NPC306765

Ingredient ID: NPC305660

Ingredient ID: NPC304380

Ingredient ID: NPC303870

Ingredient ID: NPC299405

Ingredient ID: NPC29649

Ingredient ID: NPC296337

Ingredient ID: NPC295777

Ingredient ID: NPC294136

Ingredient ID: NPC293894

Ingredient ID: NPC292792

Ingredient ID: NPC291517

Ingredient ID: NPC289143

Ingredient ID: NPC284731

Ingredient ID: NPC283655

Ingredient ID: NPC279026

Ingredient ID: NPC278072

Ingredient ID: NPC275610

Ingredient ID: NPC268862

Ingredient ID: NPC260951

Ingredient ID: NPC259134

Ingredient ID: NPC257124

Ingredient ID: NPC257003

Ingredient ID: NPC256463

Ingredient ID: NPC252841

Ingredient ID: NPC252257

Ingredient ID: NPC247961

Ingredient ID: NPC246693

Ingredient ID: NPC242358

Ingredient ID: NPC241349

Ingredient ID: NPC235059

Ingredient ID: NPC231738

Ingredient ID: NPC230726

Ingredient ID: NPC225582

Ingredient ID: NPC222001

Ingredient ID: NPC21836

Ingredient ID: NPC217226

Ingredient ID: NPC216630

Ingredient ID: NPC216312

Ingredient ID: NPC216124

Ingredient ID: NPC215008

Ingredient ID: NPC212707

Ingredient ID: NPC210288

Ingredient ID: NPC210175

Ingredient ID: NPC209275

Ingredient ID: NPC208075

Ingredient ID: NPC207324

Ingredient ID: NPC199052

Ingredient ID: NPC196490

Ingredient ID: NPC194944

Ingredient ID: NPC193180

Ingredient ID: NPC192601

Ingredient ID: NPC189853

Ingredient ID: NPC189325

Ingredient ID: NPC189197

Ingredient ID: NPC189036

Ingredient ID: NPC186903

Ingredient ID: NPC186098

Ingredient ID: NPC185189

Ingredient ID: NPC18074

Ingredient ID: NPC180684

Ingredient ID: NPC178223

Ingredient ID: NPC174368

Ingredient ID: NPC173996

Ingredient ID: NPC173078

Ingredient ID: NPC172918

Ingredient ID: NPC171530

Ingredient ID: NPC169222

Ingredient ID: NPC168799

Ingredient ID: NPC167385

Ingredient ID: NPC167041

Ingredient ID: NPC166894

Ingredient ID: NPC164359

Ingredient ID: NPC163748

Ingredient ID: NPC16157

Ingredient ID: NPC161097

Ingredient ID: NPC156455

Ingredient ID: NPC155209

Ingredient ID: NPC151140

Ingredient ID: NPC150031

Ingredient ID: NPC14682

Ingredient ID: NPC144557

Ingredient ID: NPC139545

Ingredient ID: NPC13789

Ingredient ID: NPC134047

Ingredient ID: NPC131981

Ingredient ID: NPC122768

Ingredient ID: NPC122647

Ingredient ID: NPC119381

Ingredient ID: NPC11467

Ingredient ID: NPC111422

Ingredient ID: NPC110609

Ingredient ID: NPC109813

Ingredient ID: NPC108375

Ingredient ID: NPC108218

Ingredient ID: NPC106250

Ingredient ID: NPC104195

Ingredient ID: NPC103326

Ingredient ID: NPC101285