• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Eclipta Prostrata


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GGGGCAGGTCGATCNTGCCAGCAGAACGACCTGTGACATGTAAAACAATCGGCTTCACCGGGACTAAAGTTTTGCTTTGGTCCTCGTGAAGCATTGTTGACGTGTGTTCATGTTCGTCCCATTTGGGCGTCATGGATATCAAGTTGACACAACAACCCCCGGCACGACATGTGCCAAGGAGAACTAAACTTAAAGAGCTTGTGTTATGACGCCCCGCTTTCGGTGTGCGCATTGCACATGGCTTCTTTGTAAACTCAAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGATGCCATCTGGTTGAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCGCCCCCACCAAACCATCCTCATTAGGGGAAGTGTTGTGTTGGGGCGGAGATTGGTCTCCTGCGCTAAGGGCGTGGTTGGCCTAAATAGGAGTCTTCTTACGAGAGACGCACGACTAGTGGTGGTTGATACGACAGTCGTCTCGTGTTGTGCGTTTTAAATTGTGAGCGGATACTCTTGAAATACCCTAACGTGTTGTCTTGTGACGATGCCTCGA

Click for details-----ITS1

ATGTCGAATCCTGCACGGCAGAACGACCTGTGAACATGTAAAACAATCGGCTTCACCGGGACTAAAGTTTTGCTTTGGTCCTCGTGAAGCATTGTTGACGTGTGTTCATGTTCGTCCCATTTGGGCGTCATGGATATCAAGTTGACACAACAACCCCCGGCACGACATGTGCCAAGGAGAACTAAACTTAAAGAGCTTGTGTTATGACGCCCCGCTTTCGGTGTGCGCATTGCACATGGCTTCTTTGTAAACTCAAAA

Click for details-----ITS2

ATCACGTCGCCCCCACCAAACCATCCTCATTAGGGGAAGTGTTGTGTTGGGGCGGAGATTGGCCTCCTGCGCTAAGGGTGTGGTTGGCCTAAATAGGAGTCTTCTTACGAGAGACGCACGACTAGTGGTGGTTGATACGACAGTCGTCTCGTGTTGTGCGTTTTAAATTGTGAGCGGATACTCTTGAAATACCCTAACGTGTTGTCTTGTGACGATGCCTCGATCGCGACCCCAGTCAGCGGACA
Taxonomic Information

Plant ID: NPO20295
Plant Latin Name: Eclipta Prostrata
Taxonomy Genus: Eclipta
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: 53719
Plant-of-the-World-Online: 1186403-2

Used in Medicines

Country/Region:
Ghana; China; Indonesia; India; Thailand

Traditional Medicine System:
Sowa-Rigpa; Indian Folk; Unani; Siddha; Ayurveda; TCM


Medicinal Functions:

Antiseptic; Astringent; Depurative; Emetic; Febrifuge; Ophthalmic; Purgative; Styptic; Tonic

Geographical Distribution

Canada; Afghanistan; Madagascar; Suriname; Kuwait; Cambodia; Bahamas; Rwanda; Sri Lanka; Peru; Laos; Argentina; Bolivia; Venezuela; Cote d'Ivoire; Ecuador; Ghana; Russia; Australia; Iran; Cuba; El Salvador; Thailand; Zambia; Malawi; Zimbabwe; China; Chile; Germany; Dominican Republic; Belize; Spain; Ukraine; Mauritania; Georgia; Paraguay; Oman; Turkey; Indonesia; Saudi Arabia; Swaziland; Morocco; Uruguay; French Guiana; Guinea-Bissau; Guyana; Namibia; Yemen; Haiti; Brazil; Bulgaria; United States; Romania; Angola; Myanmar; Mexico; South Africa; India; Lesotho; Vietnam; Mozambique; Burundi; Japan; Taiwan; Botswana

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

124 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


36 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

34 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC96817

Ingredient ID: NPC94796

Ingredient ID: NPC93075

Ingredient ID: NPC93020

Ingredient ID: NPC89422

Ingredient ID: NPC86668

Ingredient ID: NPC86477

Ingredient ID: NPC85813

Ingredient ID: NPC85550

Ingredient ID: NPC77382

Ingredient ID: NPC76006

Ingredient ID: NPC69445

Ingredient ID: NPC67462

Ingredient ID: NPC66577

Ingredient ID: NPC62334

Ingredient ID: NPC58841

Ingredient ID: NPC52005

Ingredient ID: NPC50898

Ingredient ID: NPC48564

Ingredient ID: NPC424

Ingredient ID: NPC40089

Ingredient ID: NPC39379

Ingredient ID: NPC39167

Ingredient ID: NPC38751

Ingredient ID: NPC3245

Ingredient ID: NPC323240

Ingredient ID: NPC319585

Ingredient ID: NPC309318

Ingredient ID: NPC306990

Ingredient ID: NPC306478

Ingredient ID: NPC302857

Ingredient ID: NPC302731

Ingredient ID: NPC296677

Ingredient ID: NPC294457

Ingredient ID: NPC29172

Ingredient ID: NPC290613

Ingredient ID: NPC29

Ingredient ID: NPC288932

Ingredient ID: NPC285436

Ingredient ID: NPC285154

Ingredient ID: NPC283923

Ingredient ID: NPC281428

Ingredient ID: NPC281090

Ingredient ID: NPC280547

Ingredient ID: NPC279121

Ingredient ID: NPC274411

Ingredient ID: NPC271086

Ingredient ID: NPC270699

Ingredient ID: NPC26960

Ingredient ID: NPC264425

Ingredient ID: NPC264317

Ingredient ID: NPC262649

Ingredient ID: NPC261831

Ingredient ID: NPC256546

Ingredient ID: NPC253773

Ingredient ID: NPC251641

Ingredient ID: NPC249014

Ingredient ID: NPC248726

Ingredient ID: NPC244702

Ingredient ID: NPC241704

Ingredient ID: NPC240340

Ingredient ID: NPC239406

Ingredient ID: NPC237837

Ingredient ID: NPC236607

Ingredient ID: NPC235589

Ingredient ID: NPC233533

Ingredient ID: NPC230301

Ingredient ID: NPC216630

Ingredient ID: NPC213063

Ingredient ID: NPC210537

Ingredient ID: NPC210234

Ingredient ID: NPC209970

Ingredient ID: NPC209611

Ingredient ID: NPC20742

Ingredient ID: NPC205746

Ingredient ID: NPC205513

Ingredient ID: NPC195713

Ingredient ID: NPC193180

Ingredient ID: NPC192403

Ingredient ID: NPC191375

Ingredient ID: NPC190658

Ingredient ID: NPC189689

Ingredient ID: NPC189142

Ingredient ID: NPC188727

Ingredient ID: NPC18825

Ingredient ID: NPC186941

Ingredient ID: NPC183959

Ingredient ID: NPC182571

Ingredient ID: NPC182107

Ingredient ID: NPC182102

Ingredient ID: NPC179174

Ingredient ID: NPC174171

Ingredient ID: NPC173019

Ingredient ID: NPC170838

Ingredient ID: NPC167976

Ingredient ID: NPC166924

Ingredient ID: NPC164858

Ingredient ID: NPC164456

Ingredient ID: NPC164158

Ingredient ID: NPC158329

Ingredient ID: NPC157297

Ingredient ID: NPC155182

Ingredient ID: NPC15439

Ingredient ID: NPC149172

Ingredient ID: NPC148473

Ingredient ID: NPC148086

Ingredient ID: NPC147116

Ingredient ID: NPC145040

Ingredient ID: NPC144462

Ingredient ID: NPC14148

Ingredient ID: NPC133449

Ingredient ID: NPC131190

Ingredient ID: NPC130230

Ingredient ID: NPC121126

Ingredient ID: NPC120559

Ingredient ID: NPC118133

Ingredient ID: NPC117493

Ingredient ID: NPC11691

Ingredient ID: NPC115062

Ingredient ID: NPC114031

Ingredient ID: NPC109868

Ingredient ID: NPC108724

Ingredient ID: NPC10321

Ingredient ID: NPC101428