• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Dorstenia Lindeniana


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCATAGCAGAAAAACTTGTGAACATACATGACCAACTCGGAGAGATCAAGGAGCTGTATAGAGCCTTGGATCCCTGTATTGTGCTTGGGTGGGGTGCGGCTTTTGTCCACTCCCGTCAACACAAAAAACGAACCCCGGCGCAGAATGCGTCAAGGAATATGAAAAAACAAAATGACTTACACCGCCATTGCCCCGGAGACGGTGTGTTGTGACGGTTGATTTGTTATTGGTTTTATGTTATAACAACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCCGGTTGAGGGCATGTCTGCCTGGGCGTCACACATCATAGCCCCCCCCCAATTATCCCACTTCACTCCCTGTCGGGTGTGTTAGGTCTCTGATTGGGTGTGGCGGAAGATGGCCTCCCGTGTGTGCAATCATGCGGTTGGCTGAAAATCAAGTCCTCGGTCACATTATCGTGACGTTAGGTGGTTGTTGACAATCTCGACGTACCCCGTTGCGTGTGTAGAACCAGGACTTCAAGACCCCGCGATGCTCCATTCATTGAAGCTTCCA

Click for details-----ITS1

TCGAAACCTGCATAGCAGAAAAACTTGTGAACATACATGACCAACTCGGAGAGATCAAGGAGCTGTATAGAGCCTTGGATCCCTGTATTGTGCTTGGGTGGGGTGCGGCTTTTGTCCACTCCCGTCAACACAAAAAACGAACCCCGGCGCAGAATGCGTCAAGGAATATGAAAAAACAAAATGACTTACACCGCCATTGCCCCGGAGACGGTGTGTTGTGACGGTTGATTTGTTATTGGTTTTATGTTATAA

Click for details-----ITS2

ATCATAGCCCCCCCCCAATTATCCCACTTCACTCCCTGTCGGGTGTGTTAGGTCTCTGATTGGGTGTGGCGGAAGATGGCCTCCCGTGTGTGCAATCATGCGGTTGGCTGAAAATCAAGTCCTCGGTCACATTATCGTGACGTTAGGTGGTTGTTGACAATCTCGACGTACCCCGTTGCGTGTGTAGAACCAGGACTTCAAGACCCCGCGATGCTCCATTCATTGAAGCTTCCA
Taxonomic Information

Plant ID: NPO20209
Plant Latin Name: Dorstenia Lindeniana
Taxonomy Genus: Dorstenia
Taxonomy Family: Moraceae

Plant External Links:

NCBI TaxonomyDB: 984813
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

143 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


39 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

56 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99408

Ingredient ID: NPC97680

Ingredient ID: NPC97131

Ingredient ID: NPC9666

Ingredient ID: NPC92569

Ingredient ID: NPC88130

Ingredient ID: NPC87263

Ingredient ID: NPC86412

Ingredient ID: NPC86133

Ingredient ID: NPC84319

Ingredient ID: NPC82853

Ingredient ID: NPC81995

Ingredient ID: NPC8094

Ingredient ID: NPC79834

Ingredient ID: NPC79742

Ingredient ID: NPC75234

Ingredient ID: NPC74942

Ingredient ID: NPC74428

Ingredient ID: NPC72924

Ingredient ID: NPC6773

Ingredient ID: NPC57495

Ingredient ID: NPC5447

Ingredient ID: NPC52622

Ingredient ID: NPC51700

Ingredient ID: NPC46274

Ingredient ID: NPC44996

Ingredient ID: NPC446

Ingredient ID: NPC44260

Ingredient ID: NPC44083

Ingredient ID: NPC43918

Ingredient ID: NPC43357

Ingredient ID: NPC41424

Ingredient ID: NPC40702

Ingredient ID: NPC38408

Ingredient ID: NPC38145

Ingredient ID: NPC380

Ingredient ID: NPC37502

Ingredient ID: NPC33611

Ingredient ID: NPC32089

Ingredient ID: NPC311907

Ingredient ID: NPC31039

Ingredient ID: NPC307063

Ingredient ID: NPC305959

Ingredient ID: NPC302436

Ingredient ID: NPC300790

Ingredient ID: NPC295417

Ingredient ID: NPC293908

Ingredient ID: NPC293378

Ingredient ID: NPC291957

Ingredient ID: NPC289196

Ingredient ID: NPC287965

Ingredient ID: NPC285839

Ingredient ID: NPC285047

Ingredient ID: NPC283655

Ingredient ID: NPC281570

Ingredient ID: NPC279121

Ingredient ID: NPC27657

Ingredient ID: NPC276349

Ingredient ID: NPC272123

Ingredient ID: NPC26861

Ingredient ID: NPC267627

Ingredient ID: NPC26703

Ingredient ID: NPC265273

Ingredient ID: NPC264317

Ingredient ID: NPC264145

Ingredient ID: NPC261831

Ingredient ID: NPC259838

Ingredient ID: NPC259533

Ingredient ID: NPC258733

Ingredient ID: NPC252833

Ingredient ID: NPC25162

Ingredient ID: NPC249823

Ingredient ID: NPC248956

Ingredient ID: NPC24858

Ingredient ID: NPC247713

Ingredient ID: NPC243728

Ingredient ID: NPC237898

Ingredient ID: NPC237643

Ingredient ID: NPC237202

Ingredient ID: NPC230301

Ingredient ID: NPC228914

Ingredient ID: NPC227030

Ingredient ID: NPC225710

Ingredient ID: NPC225585

Ingredient ID: NPC221758

Ingredient ID: NPC220831

Ingredient ID: NPC219600

Ingredient ID: NPC219092

Ingredient ID: NPC218860

Ingredient ID: NPC217586

Ingredient ID: NPC213352

Ingredient ID: NPC211550

Ingredient ID: NPC20791

Ingredient ID: NPC205037

Ingredient ID: NPC202713

Ingredient ID: NPC19783

Ingredient ID: NPC196336

Ingredient ID: NPC195491

Ingredient ID: NPC195196

Ingredient ID: NPC192638

Ingredient ID: NPC191306

Ingredient ID: NPC190501

Ingredient ID: NPC189224

Ingredient ID: NPC187838

Ingredient ID: NPC184571

Ingredient ID: NPC184171

Ingredient ID: NPC181823

Ingredient ID: NPC179548

Ingredient ID: NPC178383

Ingredient ID: NPC178134

Ingredient ID: NPC175854

Ingredient ID: NPC175793

Ingredient ID: NPC175013

Ingredient ID: NPC173977

Ingredient ID: NPC169749

Ingredient ID: NPC169022

Ingredient ID: NPC168636

Ingredient ID: NPC168623

Ingredient ID: NPC166851

Ingredient ID: NPC165382

Ingredient ID: NPC16024

Ingredient ID: NPC157340

Ingredient ID: NPC155825

Ingredient ID: NPC153031

Ingredient ID: NPC146066

Ingredient ID: NPC144109

Ingredient ID: NPC143851

Ingredient ID: NPC142415

Ingredient ID: NPC14030

Ingredient ID: NPC139622

Ingredient ID: NPC135222

Ingredient ID: NPC129530

Ingredient ID: NPC125352

Ingredient ID: NPC125136

Ingredient ID: NPC124639

Ingredient ID: NPC123259

Ingredient ID: NPC121162

Ingredient ID: NPC120503

Ingredient ID: NPC119289

Ingredient ID: NPC113733

Ingredient ID: NPC109878

Ingredient ID: NPC104281

Ingredient ID: NPC104222