• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Prunus Sibirica


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GGAAGGATCATTGTCGAAACCTGCCTAGCAGAACGACCCGAGAACTAGTTTCAAAGCGGGGGACGAGGGGCCGTCTCGGCGTGCTCCTCGTCCCTTTATCYCGGGGGGGTTCATACCCTTCCGGGCGTACAAACGAACACCGGCGCGAATTGCGCCAAGGAACTTGAACGAGAGAGCGCGTCCCTGTCGCCCCGGAAACGGTGTGCGATGGCGGCGTCGTCATCTTCAAATATGTCAAAACGACTTTTGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCCCCCATCTACTCCTTCGGGATTGYGGGGGGCGGATGATGGCCTCCCGTGCGCCTCGTCGCGCGGTTGGCATAAATGCCAAGTCCTCGGCGACGCACGCCATGACAATCGGTGGTTGCGAAACCTCGGTTGCCCGTCGTGTGCGGTCGTCGCGCATCGAGGGCTCGAAAAAATTGCCGGGCTCCGGCTCGGCTTTCA

Click for details-----ITS1

GGAAGGATCATTGTCGAAACCTGCCTAGCAGAACGACCCGAGAACTAGTTTCAAAGCGGGGGACGAGGGGCCGTCTCGGCGTGCTCCTCGTCCCTTTATCYCGGGGGGGTTCATACCCTTCCGGGCGTACAAACGAACACCGGCGCGAATTGCGCCAAGGAACTTGAACGAGAGAGCGCGTCCCTGTCGCCCCGGAAACGGTGTGCGATGGCGGCGTCGTCATCTTCAAATATGTCAAAA

Click for details-----ITS2

GTCGTTGCCCCCCCCATCTACTCCTTCGGGATTGYGGGGGGCGGATGATGGCCTCCCGTGCGCCTCGTCGCGCGGTTGGCATAAATGCCAAGTCCTCGGCGACGCACGCCATGACAATCGGTGGTTGCGAAACCTCGGTTGCCCGTCGTGTGCGGTCGTCGCGCATCGAGGGCTCGAAAAAATTGCCGGGCTCCGGCTCGGCTTTCA
Taxonomic Information

Plant ID: NPO20032
Plant Latin Name: Prunus Sibirica
Taxonomy Genus: Prunus
Taxonomy Family: Rosaceae

Plant External Links:

NCBI TaxonomyDB: 151440
Plant-of-the-World-Online: n.a.

Used in Medicines

Unknown.

Geographical Distribution
Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available
Compounds Summary

Overview of Ingredients

80 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


29 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

27 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.





Ingredient Structrual Cards

Ingredient ID: NPC96123

Ingredient ID: NPC89325

Ingredient ID: NPC85813

Ingredient ID: NPC83137

Ingredient ID: NPC80776

Ingredient ID: NPC80670

Ingredient ID: NPC7855

Ingredient ID: NPC78500

Ingredient ID: NPC7599

Ingredient ID: NPC75204

Ingredient ID: NPC7479

Ingredient ID: NPC74097

Ingredient ID: NPC65326

Ingredient ID: NPC62765

Ingredient ID: NPC58792

Ingredient ID: NPC56325

Ingredient ID: NPC54726

Ingredient ID: NPC48623

Ingredient ID: NPC47654

Ingredient ID: NPC424

Ingredient ID: NPC40733

Ingredient ID: NPC38579

Ingredient ID: NPC36517

Ingredient ID: NPC34393

Ingredient ID: NPC310820

Ingredient ID: NPC306169

Ingredient ID: NPC302025

Ingredient ID: NPC296734

Ingredient ID: NPC290876

Ingredient ID: NPC288986

Ingredient ID: NPC286134

Ingredient ID: NPC280749

Ingredient ID: NPC280486

Ingredient ID: NPC278021

Ingredient ID: NPC273858

Ingredient ID: NPC269192

Ingredient ID: NPC266389

Ingredient ID: NPC264553

Ingredient ID: NPC264495

Ingredient ID: NPC261831

Ingredient ID: NPC258770

Ingredient ID: NPC254324

Ingredient ID: NPC25252

Ingredient ID: NPC248944

Ingredient ID: NPC24625

Ingredient ID: NPC242580

Ingredient ID: NPC24106

Ingredient ID: NPC232037

Ingredient ID: NPC230301

Ingredient ID: NPC227260

Ingredient ID: NPC220847

Ingredient ID: NPC216605

Ingredient ID: NPC216515

Ingredient ID: NPC211237

Ingredient ID: NPC209912

Ingredient ID: NPC208363

Ingredient ID: NPC202827

Ingredient ID: NPC196884

Ingredient ID: NPC187993

Ingredient ID: NPC187154

Ingredient ID: NPC170094

Ingredient ID: NPC169055

Ingredient ID: NPC168707

Ingredient ID: NPC161035

Ingredient ID: NPC148347

Ingredient ID: NPC146197

Ingredient ID: NPC141769

Ingredient ID: NPC141427

Ingredient ID: NPC13475

Ingredient ID: NPC132731

Ingredient ID: NPC12910

Ingredient ID: NPC126759

Ingredient ID: NPC126142

Ingredient ID: NPC125144

Ingredient ID: NPC123871

Ingredient ID: NPC122245

Ingredient ID: NPC120817

Ingredient ID: NPC119831

Ingredient ID: NPC102504

Ingredient ID: NPC100128

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM
Target Type: Individual Protein of Homo sapiens
*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.
.

Detailed Information of Target Proteins

Target Type Protein Class Gene ID Protein Name Uniprot ID Target ChEMBL ID
Therapeutic Target Enzyme AKR1C3 Aldo-keto-reductase family 1 member C3 P42330 CHEMBL4681
Therapeutic Target Fatty acid binding protein family FABP5 Fatty acid binding protein epidermal Q01469 CHEMBL3674
Therapeutic Target Nuclear hormone receptor subfamily 1 PPARA Peroxisome proliferator-activated receptor alpha Q07869 CHEMBL239
Therapeutic Target Oxidoreductase ALOX15 Arachidonate 15-lipoxygenase P16050 CHEMBL2903
Drug Transporter SLC superfamily of solute carriers SLCO1B3 Solute carrier organic anion transporter family member 1B3 Q9NPD5 CHEMBL1743121
Drug Transporter SLC superfamily of solute carriers SLCO1B1 Solute carrier organic anion transporter family member 1B1 Q9Y6L6 CHEMBL1697668
Therapeutic Target Small molecule receptor (family A GPCR) FFAR4 G-protein coupled receptor 120 Q5NUL3 CHEMBL5339
Therapeutic Target Small molecule receptor (family A GPCR) FFAR1 Free fatty acid receptor 1 O14842 CHEMBL4422
Therapeutic Target Structural protein LMNA Prelamin-A/C P02545 CHEMBL1293235
Therapeutic Target Transferase GSTP1 Glutathione S-transferase Pi P09211 CHEMBL3902
Clinical Trials Summary
Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type Number of clinical trials
NP level10
Clinical trial details
NCT ID Title Condition Form in clinical use Associated by plant or compound
NCT01792310 A Phase 1/2A Study of LAM561 in Adult Patients With Advanced Solid Tumours glioma Oleic Acid (NPC261831) NP level
NCT00607945 Dietary Fatty Acids as Complementary Therapy in Type 2 Diabetes Mellitus type 2 diabetes mellitus Linoleic Acid (NPC85813) NP level
NCT00029679 Borage Oil and Ginkgo Biloba (EGb 761) in Asthma asthma Linoleic Acid (NPC85813) NP level
NCT00951158 A Molecular Pharmacodynamic Dose-titration Trial of Conjugated Linoleic Acid (CLA; Clarinol®) in Patients With Advanced Solid Tumors neoplasm Linoleic Acid (NPC85813) NP level
NCT02063802 Metformin vs Conjugated Linoleic Acid and an Intervention Program With Healthy Habits in Obese Children obesity Linoleic Acid (NPC85813) NP level
NCT00204932 Effects of CLA Supplements on Body Weight and Fat Oxidation obesity Linoleic Acid (NPC85813) NP level
NCT01661764 Fish Oil Supplementation, Nutrigenomics and Colorectal Cancer Prevention colorectal adenoma Oleic Acid (NPC261831) NP level
NCT00638196 Placebo vs. Linoleic Acid Controlled Assessment of Treatment Efficacy in MS multiple sclerosis Oleic Acid (NPC261831) NP level
NCT00908791 Proof of Principle Trial to Determine if Nutritional Supplement Conjugated Linoleic Acid (CLA) Can Modulate the Lipogenic Pathway in Breast Cancer Tissue breast cancer Linoleic Acid (NPC85813) NP level
NCT03444298 A Study of Gamma Tocopherol-enriched Supplement on Lower Airway Responses to Inhaled Wood Smoke in Healthy Adults asthma;inflammation (2R)-2,7,8-Trimethyl-2-[(4R,8R)-4,8,12-Trimethyltridecyl]-3,4-Dihydrochromen-6-Ol (NPC48623) NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

 How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
 ❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant
Association Type & Detailed Evidence
Adenocarcinoma of pancreas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10.0
 F2,FFAR4,GSTP1,AKR1C3,SLCO1B3,NAPRT,FABP3,ALOX15,LMNA
Diffuse large B-cell lymphomas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A81
 PPARA,GSTP1,FFAR1,FABP3,FABP5,FABP4,LMNA
Serous cystadenoma,borderline malignancy of ovary
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C73.4
 FFAR4,GSTP1,ALOX15,SLCO1B3,FABP3,FABP5
Carcinosarcoma of uterus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76.43
 FFAR4,GSTP1,ALOX15,FFAR1,FABP5
Malignant neoplasm metastasis in lymph nodes of head, face or neck
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D60.0
 F2,SLCO1B1,AKR1C3,SLCO1B3,FABP4
Other specified malignant neoplasms of kidney, except renal pelvis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C90.Y
 FABP5,FFAR4,FABP5,F2,FFAR4
Mesothelioma of pleura
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C26.0
 FFAR4,GSTP1,FFAR1,ALOX15,LMNA
Type 2 diabetes mellitus
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A11
 PPARA,FFAR1,F2
 NCT00607945
Hepatoblastoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12.01
 FABP5,FABP4,FABP3,GSTP1
Adenocarcinoma of stomach
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B72.0
 F2,SLCO1B1,ALOX15,SLCO1B3
Squamous cell carcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.2
 F2,SLCO1B1,AKR1C3,SLCO1B3
Hepatocellular carcinoma of liver
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12.02
 FABP5,AKR1C3,FABP4,AKR1C3
Adenocarcinoma of prostate
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C82.0
 SLCO1B1,ALOX15,SLCO1B3,FABP5
Adenocarcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.0
 F2,SLCO1B1,AKR1C3,SLCO1B3
Germ cell tumour of testis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C80.2
 F2,SLCO1B1,FABP3,FABP5
Asthma
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA23
 F2
 NCT00029679,NCT03444298
Malignant neoplasms of biliary tract, distal bile duct
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C15
 GSTP1,FABP5,LMNA
Other specified malignant neoplasms ofcolon
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B90.Y
 F2,SLCO1B3,SLCO1B1
Melanoma of skin
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C30
 GSTP1,FFAR1,FABP3
Superficial ovarian endometriosis
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA10.B4
 LMNA,FABP3,GSTP1
Malignant neoplasms of oesophagus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B70
 ALOX15,SLCO1B3,SLCO1B1
Malignant neoplasms of corpus uteri, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76.Z
 F2,SLCO1B3,ALOX15
Malignant neoplasms of thymus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C27
 FFAR4,ALOX15,FABP5
Malignant neoplasms of adrenal gland
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D11
 FABP5,FFAR1,FABP3
Cardiovascular disease
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA00-BE2Z
 F2,PPARA
Solid tumour/cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00-2F9Z
 GSTP1,PPARA
Multiple sclerosis
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A40
 F2
 NCT00638196
Acute diabete complication
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A2Y
 FFAR1,PPARA
Non-alcoholic fatty liver disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB92
 PPARA
 FABP4
Colorectal cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B91
 GSTP1
 NCT01661764
Obesity
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5B80-5B81
 NCT02063802,NCT00204932
Other specified malignant neoplasms of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.Y
 AKR1C3,SLCO1B3
Urothelial carcinoma of bladder
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C94.2
 SLCO1B3,SLCO1B1
Chikungunya virus disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D40
 FFAR1,LMNA
Glioblastoma of brain
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00.00
 FABP5,LMNA
Prostate cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C82
 AKR1C3
Dyslipidemia
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C80-5C81
 PPARA
Ischaemic/haemorrhagic stroke
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8B20
 F2
Nutritional deficiency
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5B50-5B71
 F2
Myelodysplastic syndrome
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A37
 GSTP1
Idiopathic interstitial pneumonitis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CB03
 FFAR1
Angina pectoris
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA40
 F2
Coagulation defect
Disease Category: 03.Diseases of the blood or blood-forming organs
Disease ICD-11 Code: 3B10
 F2
Bleeding disorder
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA20-GA21
 F2
Female pelvic pain
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA34
 AKR1C3
Lung cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25
 GSTP1
Hyperlipidemia
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C80
 PPARA
Myocardial infarction
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA41-BA43
 F2
Thrombocytopenia
Disease Category: 03.Diseases of the blood or blood-forming organs
Disease ICD-11 Code: 3B64
 F2
Inborn lipid metabolism error
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C52
 PPARA
Coronary thrombosis
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA43
 F2
Pancreatic cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10
 GSTP1
Cerebral ischaemic stroke
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8B11
 F2
Hyper-lipoproteinaemia
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C80
 PPARA
Gout
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA25
 PPARA
Diabetes mellitus, type unspecified
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A14
 PPARA
Thrombosis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB61-GB90
 F2
Breast cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C60-2C6Y
 NCT00908791
Glioma, malignant
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH4RQ3
 NCT01792310
Neoplasms
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 02
 NCT00951158
NA
Disease Category: NA
Disease ICD-11 Code: NA
 NCT03444298
Crohn disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD70
 SLCO1B3
Pheochromocytoma
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH3854
 FABP5
Inflammatory bowel diseases, unspecified
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD7Z
 SLCO1B3
Psoriasis
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA90
 FABP5
Idiopathic pulmonary fibrosis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CB03.4
 SLCO1B3
Malignant neoplasms of bladder
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C94
 FABP4
Tetralogy of Fallot
Disease Category: 20.Developmental anomalies
Disease ICD-11 Code: LA88.2
 F2
Cytomegaloviral disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D82
 ALOX15
Systemic sclerosis
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A42
 FABP4
Systemic lupus erythematosus
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A40.0
 FFAR1
Malignant neoplasms of thyroid gland, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D10.Z
 FFAR1
Malignant neoplasms of stomach
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B72
 FABP4
Polycystic ovary syndrome
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A80.1
 FFAR4
Human immunodeficiency virus disease without mention of tuberculosis or malaria
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1C62
 FFAR1
Carpal tunnel syndrome
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C10.0
 FFAR4
Malignant neoplasm of pancreas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10
 FABP4
Gliomas of brain
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00.0
 AKR1C3

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network 
Data Section
Select to Download
1. General Info & Plant Usage & Geographical Distribution  
2. Plant Ingredients  
3. Collective Molecular Proteins  
4. Collective Enriched Activities  
5. Plant molecular targets overlapping with DEGs  
6. Associated clinical trials  
7. Associated Human Diseases  
>> Targets derived from weak experimental activities
About Us

The CMAUP database is developed by the Bioinformatics & Drug Design group (BIDD) and School of Pharmacy, Fudan University.

CMAUP

Home

About

Browse

Help

Useful links

BIDD home

NPASS database

TCM-ID database

TTD database

Contact

826 Zhangheng Road, Pudong New District, Shanghai, China

Principle Investigator:
Prof. Chen Yu Zong
chenyuzong@sz.tsinghua.edu.cn
Prof. Zeng Xian
zengxian@fudan.edu.cn

Developer & Maintainer:
Ph.D. Student Dongyue Hou
dyhou22@m.fudan.edu.cn
Mr. Hanbo Lin
hblin19@fudan.edu.cn
Ms. Yuhan Feng
yhfeng22@m.fudan.edu.cn

© 2023 Copyright: Bioinformatics & Drug Design group