• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Pycnandra Acuminata


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACTTGCCAAGCAGAACGACCCGCGAACTAGTAAATAAAGCTGTCATCGGGGGTGCTTAGTGGCGGGCTTGACTGCCCCCTCTCTTTGCCCCCCTCGCCGGGTGCGCTATTTAACTGCGTTCCTCGGCTAAAAACAAACCCCGGCGCGAATCGCGTCAAGGAACTCAAACAAGAGGGAAGAGAAGCGCGCCCCCCCGGTTCTCGTTCGCGAGTGAAGCTGTTGGGGGGTGGCAGTCGCATCTTTCATGAACATAATAACGAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCTCACATTGCGTCGCCCCTCGCCCGGTGCCCGCAAAGGGTTCCTGGGTTGATGGGGGCGGATTTTGGCCCCCCGTGTGCCCTAGTGCGCGGTCGGCCTAAAGATGAGTCGCTGGCGACGAACGTCACGATGAGTGGTGGATGTGATAACGTTGCGTCATGTCGTGCACGTCTCGTCCCAACGGGTTGTTTTGGTAAATTGGCCTCGAAAGCACCGTTTCCACGGTGCATCGA

Click for details-----ITS1

TCGAAACTTGCCAAGCAGAACGACCCGCGAACTAGTATATAAAGCTGTCATCGGGGGTGCTTTGTGGCGGGCTTGACTGCCCCCTCTCTTTGCCCCCCTCGCCGGGTGCGCTATTTAACTGCGTTCCTCGGCTAAAAACAAACCCCGGCGCGAATCGCGTCAAGGAACTCAAACAAGAGGGAAGAGAAGCGCGCCCCCCCGGTTTTCGTTCGCGAGTGAAGTGAAGCTGTTGGGGGGTGGCAGTCGCATCTTTCATGAACATAATAA

Click for details-----ITS2

ATTGCGTCGCCCCTCGCCCGGTGCCCGCAAAGGGTTCCTGGGTTGATGGGGGCGGATTTTGGCCCCCCGTGTGCCCTAGTGCGCGGTCGGCCTAAAGATGAGTCGCTGGCGACGAACGTCACAATGAGTGGTGGATGTGATAACGTTGCGTCATGTCGTGCACGTCTCGTCCCAACGGGTTGTTTTGGTAAATTGGCCTCGAAAGCACCGTTTCCACGGAGCATCGA
Taxonomic Information

Plant ID: NPO19975
Plant Latin Name: Pycnandra Acuminata
Taxonomy Genus: Pycnandra
Taxonomy Family: Sapotaceae

Plant External Links:

NCBI TaxonomyDB: 280718
Plant-of-the-World-Online: 77109733-1

Used in Medicines

Unknown.

Geographical Distribution

New Caledonia

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available
Compounds Summary

Overview of Ingredients

92 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


39 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

32 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.





Ingredient Structrual Cards

Ingredient ID: NPC98106

Ingredient ID: NPC95866

Ingredient ID: NPC95083

Ingredient ID: NPC91493

Ingredient ID: NPC86856

Ingredient ID: NPC8659

Ingredient ID: NPC85813

Ingredient ID: NPC84324

Ingredient ID: NPC84255

Ingredient ID: NPC80690

Ingredient ID: NPC80286

Ingredient ID: NPC78263

Ingredient ID: NPC74604

Ingredient ID: NPC72406

Ingredient ID: NPC72077

Ingredient ID: NPC71106

Ingredient ID: NPC70936

Ingredient ID: NPC66618

Ingredient ID: NPC66087

Ingredient ID: NPC53292

Ingredient ID: NPC5319

Ingredient ID: NPC50898

Ingredient ID: NPC50775

Ingredient ID: NPC49975

Ingredient ID: NPC4713

Ingredient ID: NPC45479

Ingredient ID: NPC37250

Ingredient ID: NPC35704

Ingredient ID: NPC35661

Ingredient ID: NPC34544

Ingredient ID: NPC317

Ingredient ID: NPC311484

Ingredient ID: NPC311256

Ingredient ID: NPC304870

Ingredient ID: NPC304476

Ingredient ID: NPC303625

Ingredient ID: NPC303402

Ingredient ID: NPC301377

Ingredient ID: NPC300003

Ingredient ID: NPC299856

Ingredient ID: NPC288131

Ingredient ID: NPC281131

Ingredient ID: NPC279121

Ingredient ID: NPC278419

Ingredient ID: NPC273633

Ingredient ID: NPC273436

Ingredient ID: NPC263367

Ingredient ID: NPC262826

Ingredient ID: NPC25675

Ingredient ID: NPC251178

Ingredient ID: NPC244983

Ingredient ID: NPC244881

Ingredient ID: NPC243702

Ingredient ID: NPC242149

Ingredient ID: NPC240769

Ingredient ID: NPC239385

Ingredient ID: NPC238628

Ingredient ID: NPC232187

Ingredient ID: NPC229863

Ingredient ID: NPC22150

Ingredient ID: NPC221288

Ingredient ID: NPC219053

Ingredient ID: NPC218943

Ingredient ID: NPC20791

Ingredient ID: NPC206457

Ingredient ID: NPC200785

Ingredient ID: NPC199048

Ingredient ID: NPC194836

Ingredient ID: NPC193375

Ingredient ID: NPC188210

Ingredient ID: NPC173637

Ingredient ID: NPC172158

Ingredient ID: NPC167983

Ingredient ID: NPC1587

Ingredient ID: NPC145858

Ingredient ID: NPC145720

Ingredient ID: NPC131745

Ingredient ID: NPC13143

Ingredient ID: NPC130686

Ingredient ID: NPC128563

Ingredient ID: NPC126797

Ingredient ID: NPC126714

Ingredient ID: NPC123470

Ingredient ID: NPC12063

Ingredient ID: NPC120464

Ingredient ID: NPC118495

Ingredient ID: NPC116775

Ingredient ID: NPC113163

Ingredient ID: NPC111929

Ingredient ID: NPC106367

Ingredient ID: NPC104340

Ingredient ID: NPC101731

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM
Target Type: Individual Protein of Homo sapiens
*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.
.

Detailed Information of Target Proteins

Target Type Protein Class Gene ID Protein Name Uniprot ID Target ChEMBL ID
Cytochrome P450 Cytochrome P450 family 1 CYP1A1 Cytochrome P450 1A1 P04798 CHEMBL2231
Cytochrome P450 Cytochrome P450 family 1 CYP1B1 Cytochrome P450 1B1 Q16678 CHEMBL4878
Cytochrome P450 Cytochrome P450 family 1 CYP1A2 Cytochrome P450 1A2 P05177 CHEMBL3356
Therapeutic Target Enzyme ALOX12 Arachidonate 12-lipoxygenase P18054 CHEMBL3687
Therapeutic Target Enzyme POLB DNA polymerase beta P06746 CHEMBL2392
Therapeutic Target Enzyme AKR1C3 Aldo-keto-reductase family 1 member C3 P42330 CHEMBL4681
Therapeutic Target Enzyme NOX4 NADPH oxidase 4 Q9NPH5 CHEMBL1250375
Therapeutic Target Hydrolase ACHE Acetylcholinesterase P22303 CHEMBL220
Therapeutic Target Lyase CA12 Carbonic anhydrase XII O43570 CHEMBL3242
Therapeutic Target Lyase CA4 Carbonic anhydrase IV P22748 CHEMBL3729
Therapeutic Target Lyase CA7 Carbonic anhydrase VII P43166 CHEMBL2326
Therapeutic Target Metallo protease MMP12 Matrix metalloproteinase 12 P39900 CHEMBL4393
Therapeutic Target Nuclear hormone receptor subfamily 3 ESR2 Estrogen receptor beta Q92731 CHEMBL242
Therapeutic Target Oxidoreductase HSD17B2 Estradiol 17-beta-dehydrogenase 2 P37059 CHEMBL2789
Therapeutic Target Oxidoreductase ALOX15 Arachidonate 15-lipoxygenase P16050 CHEMBL2903
Therapeutic Target Oxidoreductase HSD17B1 Estradiol 17-beta-dehydrogenase 1 P14061 CHEMBL3181
Therapeutic Target Oxidoreductase HSD17B10 Endoplasmic reticulum-associated amyloid beta-peptide-binding protein Q99714 CHEMBL4159
Therapeutic Target Peptide receptor (family A GPCR) NPSR1 Neuropeptide S receptor Q6W5P4 CHEMBL5162
Therapeutic Target Protein Kinase AXL Tyrosine-protein kinase receptor UFO P30530 CHEMBL4895
Therapeutic Target Protein Kinase IGF1R Insulin-like growth factor I receptor P08069 CHEMBL1957
Therapeutic Target Protein Kinase MKNK2 MAP kinase signal-integrating kinase 2 Q9HBH9 CHEMBL4204
Therapeutic Target Protein Kinase CSNK2A1 Casein kinase II alpha P68400 CHEMBL3629
Therapeutic Target Protein Kinase YES1 Tyrosine-protein kinase YES P07947 CHEMBL2073
Therapeutic Target Protein Kinase MKNK1 MAP kinase-interacting serine/threonine-protein kinase MNK1 Q9BUB5 CHEMBL4718
Therapeutic Target Protein Kinase CDK1 Cyclin-dependent kinase 1 P06493 CHEMBL308
Therapeutic Target Protein Kinase AURKB Serine/threonine-protein kinase Aurora-B Q96GD4 CHEMBL2185
Therapeutic Target Protein Kinase FLT3 Tyrosine-protein kinase receptor FLT3 P36888 CHEMBL1974
Therapeutic Target Protein Kinase MET Hepatocyte growth factor receptor P08581 CHEMBL3717
Therapeutic Target Protein Kinase PIM1 Serine/threonine-protein kinase PIM1 P11309 CHEMBL2147
Therapeutic Target Protein Kinase KDR Vascular endothelial growth factor receptor 2 P35968 CHEMBL279
Therapeutic Target Secreted protein THPO Thrombopoietin P40225 CHEMBL1293256
Therapeutic Target Secreted protein TTR Transthyretin P02766 CHEMBL3194
Therapeutic Target Serine protease DPP4 Dipeptidyl peptidase IV P27487 CHEMBL284
Therapeutic Target Small molecule receptor (family A GPCR) FFAR1 Free fatty acid receptor 1 O14842 CHEMBL4422
Therapeutic Target Small molecule receptor (family A GPCR) FFAR4 G-protein coupled receptor 120 Q5NUL3 CHEMBL5339
Therapeutic Target Structural protein LMNA Prelamin-A/C P02545 CHEMBL1293235
Therapeutic Target Transcription factor HIF1A Hypoxia-inducible factor 1 alpha Q16665 CHEMBL4261
Therapeutic Target Transcription factor AHR Aryl hydrocarbon receptor P35869 CHEMBL3201
Clinical Trials Summary
Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type Number of clinical trials
NP level28
Clinical trial details
NCT ID Title Condition Form in clinical use Associated by plant or compound
NCT05422885 Safety and Feasibility of Dasatinib and Quercetin in Adults at Risk for Alzheimer's Disease aging Quercetin (NPC20791) NP level
NCT01720147 Quercetin in Children With Fanconi Anemia; a Pilot Study Fanconi anemia Quercetin (NPC20791) NP level
NCT01912820 Effect of Quercetin on Green Tea Polyphenol Uptake in Prostate Tissue From Patients With Prostate Cancer Undergoing Surgery prostate adenocarcinoma Quercetin (NPC20791) NP level
NCT02558790 L-Threonic Acid Magnesium Salt (L-TAMS) in ADHD attention deficit hyperactivity disorder L-Threonic Acid (NPC35661) NP level
NCT02226484 Can Quercetin Increase Claudin-4 and Improve Esophageal Barrier Function in GERD? gastroesophageal reflux disease Quercetin (NPC20791) NP level
NCT00951158 A Molecular Pharmacodynamic Dose-titration Trial of Conjugated Linoleic Acid (CLA; Clarinol®) in Patients With Advanced Solid Tumors neoplasm Linoleic Acid (NPC85813) NP level
NCT01708278 Beneficial Effects of Quercetin in Chronic Obstructive Pulmonary Disease (COPD) chronic obstructive pulmonary disease Quercetin (NPC20791) NP level
NCT04851821 The Effectiveness of Phytotherapy in SARS-COV2(COVID-19) COVID-19 Quercetin (NPC20791) NP level
NCT05062486 A Study to Evaluate the Safety and Efficacy of RQC for AMD age-related macular degeneration Quercetin (NPC20791) NP level
NCT04907253 Quercetin in Coronary Artery By-pass Surgery coronary artery disease Quercetin (NPC20791) NP level
NCT05456022 Therapeutic Efficacy of Quercetin Versus Its Encapsulated Nanoparticle on Tongue Squamous Cell Carcinoma Cell Line mouth neoplasm Quercetin (NPC20791) NP level
NCT04733534 An Open-Label Intervention Trial to Reduce Senescence and Improve Frailty in Adult Survivors of Childhood Cancer childhood cancer Quercetin (NPC20791) NP level
NCT03943459 Sirtuin-1 and Advanced Glycation End-products in Postmenopausal Women With Coronary Disease coronary artery disease Quercetin (NPC20791) NP level
NCT05276895 Effect of Natural Senolytic Agents & NLRP3 Inhibitors on Osteoarthritis osteoarthritis Quercetin (NPC20791) NP level
NCT00908791 Proof of Principle Trial to Determine if Nutritional Supplement Conjugated Linoleic Acid (CLA) Can Modulate the Lipogenic Pathway in Breast Cancer Tissue breast cancer Linoleic Acid (NPC85813) NP level
NCT01839344 Effects of Quercetin on Blood Sugar and Blood Vessel Function in Type 2 Diabetes. type 2 diabetes mellitus Quercetin (NPC20791) NP level
NCT04853199 Quercetin In The Treatment Of SARS-COV 2 COVID-19 Quercetin (NPC20791) NP level
NCT03989271 Biological Effects of Quercetin in COPD chronic obstructive pulmonary disease Quercetin (NPC20791) NP level
NCT00455416 Dietary Intervention in Follicular Lymphoma follicular lymphoma Quercetin (NPC20791) NP level
NCT02848131 Senescence in Chronic Kidney Disease chronic kidney disease Quercetin (NPC20791) NP level
NCT00204932 Effects of CLA Supplements on Body Weight and Fat Oxidation obesity Linoleic Acid (NPC85813) NP level
NCT01438320 Q-Trial in Patients With Hepatitis C chronic hepatitis C virus infection Quercetin (NPC20791) NP level
NCT01375101 Therapeutic Effect of Quercetin and the Current Treatment of Erosive and Atrophic Oral Lichen Planus oral lichen planus Quercetin (NPC20791) NP level
NCT00029679 Borage Oil and Ginkgo Biloba (EGb 761) in Asthma asthma Linoleic Acid (NPC85813) NP level
NCT04946383 Safety and Effectivness of Quercetin & Dasatinib on Epigenetic Aging aging Quercetin (NPC20791) NP level
NCT00607945 Dietary Fatty Acids as Complementary Therapy in Type 2 Diabetes Mellitus type 2 diabetes mellitus Linoleic Acid (NPC85813) NP level
NCT02063802 Metformin vs Conjugated Linoleic Acid and an Intervention Program With Healthy Habits in Obese Children obesity Linoleic Acid (NPC85813) NP level
NCT01348204 Nasal Potential Studies Utilizing Cystic Fibrosis Transmembrane Regulator (CFTR) Modulators cystic fibrosis Quercetin (NPC20791) NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

 How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
 ❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant
Association Type & Detailed Evidence
Lung cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25
 FLT3,AXL,EGFR,IGF1R,ALOX5,CDK1,KDR,MMP12,MET
Malignant neoplasms of corpus uteri, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76.Z
 CYP1A1,MMP12,NPSR1,AURKB,CYP2C9,HSD17B2,CDK1,XDH,ALOX15
Colorectal cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B91
 IGF1R,MKNK1,TP53,KDR,EGFR,FLT3,MKNK2,MET
Adenocarcinoma of stomach
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B72.0
 MMP12,NPSR1,AURKB,NOX4,CYP19A1,MET,CDK1,ALOX15
Glioblastoma of brain
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00.00
 CSNK2A3,LMNA,CYP1B1,CYP19A1,CA12,DPP4,MET,KDR
Liver cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12
 IGF1R,KDR,MKNK2,CSNK2A1,MKNK1,EGFR,MET
Acute myeloid leukaemia
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A60
 FLT3,TP53,AXL,GSK3B,PIM1,AURKB,SRC
Pheochromocytoma
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH3854
 MMP12,NOX4,MET,CA4,ACHE,XDH,TTR
Other specified malignant neoplasms of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.Y
 AKR1C3,MMP12,HSD17B1,AURKB,CA12,CDK1,XDH
Superficial ovarian endometriosis
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA10.B4
 FABP3,SRC,HSD17B1,DPP4,CA4,ACHE,LMNA
Malignant neoplasms of oesophagus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B70
 MMP12,NPSR1,AURKB,NOX4,ACHE,CDK1,ALOX15
Urothelial carcinoma of bladder
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C94.2
 AKR1B1,HSD17B1,AURKB,CYP2C9,CDK1,CYP1A2,TTR
Chikungunya virus disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D40
 FFAR1,HIF1A,AXL,CYP19A1,EGFR,XDH,LMNA
Multiple myeloma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A83
 FLT3,KDR,AXL,AHR,IGF1R,SRC
Brain cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00
 MET,HIF1A,TP53,SRC,KDR,EGFR
Malignant haematopoietic neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B33
 DPP4,CDK1,AURKB,FLT3,SRC,TP53
Other specified malignant neoplasms ofcolon
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B90.Y
 CYP1A1,MMP12,NPSR1,NOX4,MET,TYR
Melanoma of skin
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C30
 FFAR1,FABP3,IGF1R,ABCG2,NOX4,TTR
Cytomegaloviral disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D82
 CYP1A1,ESR2,THPO,CYP2C9,ACHE,ALOX15
Renal cell carcinoma, chromophobe type
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH6153
 CYP1A1,AURKB,CA12,MET,CYP1A2,TTR
Myelodysplastic syndrome
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A37
 TP53,KDR,AHR,EGFR,AXL
Alzheimer disease
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A20
 KDR,ESR2,FLT3,ACHE,MET
Acute diabete complication
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A2Y
 FFAR1,DPP4,AURKB,KDR,AKR1B1
Psoriasis
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA90
 FLT3,ALOX5,AHR,DPP4
 MMP12
Ovarian cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C73
 KDR,SRC,TP53,FLT3,MET
Leishmaniasis
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F54
 MMP12,AKR1B1,NOX4,DPP4,FLT3
Malignant neoplasm metastasis in lymph nodes of head, face or neck
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D60.0
 AKR1C3,MMP12,NPSR1,AURKB,NOX4
West Nile virus infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D46
 CYP19A1,DPP4,MET,ACHE,AXL
Invasive carcinoma of breast
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C61
 MMP12,THPO,AURKB,CA12,CDK1
Carpal tunnel syndrome
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C10.0
 THPO,CYP1B1,NOX4,DPP4,FFAR4
Peritoneal cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C51
 FLT3,TP53,SRC,KDR
Melanoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C30
 EGFR,TYR,MET,KDR
Pain, unspecified
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MG3Z
 IGF1R,ALOX5,AKR1B1,ACHE
Pancreatic cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10
 SRC,EGFR,IGF1R,TP53
Glaucoma
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9C61
 CA4,MET,AKR1B1,ACHE
Type 2 diabetes mellitus
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A11
 FFAR1,DPP4
 NCT01839344,NCT00607945
Mature B-cell leukaemia
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A82
 AXL,SRC,EGFR,TP53
Asthma
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA23
 ALOX5,CA4,MMP12
 NCT00029679
Renal cell carcinoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C90
 MMP12,MET,KDR,EGFR
Stomach cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B72
 MET,KDR,EGFR,TP53
Mature T-cell lymphoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A90
 MKNK2,EGFR,MKNK1,HIF1A
Head and neck cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D42
 KDR,EGFR,MET,TP53
Adenocarcinoma of prostate
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C82.0
 NOX4,TTR,ALOX15
 NCT01912820
Systemic lupus erythematosus
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A40.0
 FFAR1,CYP1A1,YES1,ACHE
Human immunodeficiency virus disease without mention of tuberculosis or malaria
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1C62
 FFAR1,MET,FLT3,AXL
Ebola virus disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D60.01
 ACHE,MET,AXL,HSD17B2
Gliomas of brain
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00.0
 AKR1C3,MMP12,NOX4,AHR
Prostate cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C82
 AKR1C3,AURKB,ESR2
Chronic pain
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MG30
 FLT3,KDR,EGFR
Rheumatoid arthritis
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA20
 ABCG2,AKR1B1,ALOX5
Bacterial infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1A00-1C4Z
 CA12,CYP2C9,CA4
Myeloproliferative neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A20
 GSK3B,FLT3,SRC
Idiopathic interstitial pneumonitis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CB03
 FFAR1,FLT3,ALOX5
Metastatic lymph node neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D60
 EGFR,MET,KDR
Non-small cell lung cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25
 MET,EGFR,KDR
Nasopharyngeal cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B6B
 ALOX5,EGFR,CDK1
Chronic arterial occlusive disease
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD4Z
 MET,DPP4,TP53
Pleomorphic sarcoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B54
 SRC,MET,KDR
Cardiovascular disease
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA00-BE2Z
 SRC,MET,KDR
Thrombocytopenia
Disease Category: 03.Diseases of the blood or blood-forming organs
Disease ICD-11 Code: 3B64
 KDR,AHR,ALOX5
Parkinsonism
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A00
 SRC,GSK3B,ACHE
Chronic kidney disease
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GB61
 IGF1R,XDH
 NCT02848131
Osteoarthritis, unspecified
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA0Z
 CA12,CDK1,HSD17B2
Diffuse large B-cell lymphomas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A81
 HSD17B10,THPO,CSNK2A2,NOX4,FABP3,CSNK2A1,RECQL,CA12,EGFR,CDK1,SRC,AKR1B1,CISD1,LMNA,AHR,FFAR1,AXL,ESR2,PSMB5,AURKB,ACHE,MET,TP53,KDR
Adenocarcinoma of pancreas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10.0
 ALOX5,CYP1B1,NPSR1,CYP2C9,CA7,FFAR4,TTR,ALOX15,AKR1C3,FABP3,ABCG2,PIM1,RECQL,DPP4,POLB,HIF1A,CISD1,LMNA,HSD17B2,AXL,AURKB,MET,ACHE,XDH
Mesothelioma of pleura
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C26.0
 KDR,ALOX5,CSNK2A2,FLT3,CA7,FFAR4,ALOX15,MMP12,PIM1,RECQL,CA12,DPP4,EGFR,SRC,TYR,LMNA,HSD17B2,AHR,FFAR1,AXL,AURKB,MET,CDK1,XDH
Solid tumour/cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00-2F9Z
 MKNK1,XDH,KDR,POLB,ALOX5,HIF1A,YES1,CA12,AURKB,CDK1,EGFR,AHR,AXL,GSK3B,TP53,CSNK2A1,SRC,FLT3,MET,PIM1,CA4,MKNK2,IGF1R
Germ cell tumour of testis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C80.2
 KDR,ALOX5,NPSR1,NOX4,CYP2C9,TTR,FABP3,ABCG2,CA12,DPP4,ALOX12,CA4,HIF1A,AKR1B1,AHR,HSD17B2,MET,ACHE,CDK1,XDH
Unspecific body region injury
Disease Category: 22.Injury, poisoning or certain other consequences of external causes
Disease ICD-11 Code: ND56
 MET,EGFR
Cushing syndrome
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A70
 CYP19A1,ESR2
Cervical cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C77
 TP53,SRC
Thyroid cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D10
 KDR,MET
Neuropathy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C0Z
 CYP19A1,AKR1B1
Motor neuron disease
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8B60
 SRC,IGF1R
BCR-ABL1-negative chronic myeloid leukaemia
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A41
 FLT3,SRC
Ischemia
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8B10-8B11
 EGFR,SRC
Hepatitis virus infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1E50-1E51
 ESR2,EGFR
Postoperative inflammation
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1A00-CA43
 SRC,ALOX5
Fallopian tube cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C74
 SRC,TP53
Endometrial cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76
 SRC,TP53
Pituitary gland disorder
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A60-5A61
 IGF1R,ALOX5
Osteosarcoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B51
 SRC,GSK3B
Malignant digestive organ neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C11
 KDR,SRC
Mature B-cell lymphoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A85
 FLT3,CDK1
Atopic eczema
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA80
 AHR,ALOX5
Myocardial infarction
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA41-BA43
 THPO,DPP4
NA
Disease Category: NA
Disease ICD-11 Code: NA
 MET,NOX4
Gastrointestinal stromal tumour
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B5B
 SRC,KDR
Seborrhoeic dermatitis
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA81
 CA12,CA4
Influenza
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1E30-1E32
 ALOX5,XDH
COVID-19
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D6Y
 NCT04851821,NCT04853199
Chronic obstructive pulmonary disease
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA22
 NCT01708278,NCT03989271
Obesity
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5B80-5B81
 NCT00204932,NCT02063802
Ageing associated decline in intrinsic capacity
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MG2A
 NCT05422885,NCT04946383
coronary artery disease
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA8Y-BA8Z
 NCT03943459,NCT04907253
Coeliac disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA95
 CYP1A1,CDK1
Myelodysplastic syndromes, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A3Z
 CYP2C9,PIM1
Inflammatory bowel diseases, unspecified
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD7Z
 MMP12,NOX4
Zika virus disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D48
 ACHE,AXL
Dengue fever, unspecified
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D2Z
 AURKB,ABCG2
Tetralogy of Fallot
Disease Category: 20.Developmental anomalies
Disease ICD-11 Code: LA88.2
 ABCG2,CA4
Pneumonia due to Pseudomonasaeruginosa
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA40.05
 MMP12,DPP4
Chronic rhinosinusitis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA0A
 MMP12,CYP1A1
Polycystic ovary syndrome
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A80.1
 MMP12,FFAR4
Heart failure, unspecified
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD1Z
 CYP1B1,ABCG2
Carcinosarcoma of uterus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76.43
 HSD17B10,NPSR1,CA7,FFAR4,ALOX15,MMP12,TP53,DPP4,YES1,POLB,AKR1B1,CISD1,HSD17B2,FFAR1,AURKB,CYP19A1,MET,PSMB5,XDH
Serous cystadenoma,borderline malignancy of ovary
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C73.4
 CSNK2A3,ALOX5,NOX4,CYP1A2,FFAR4,ALOX15,FABP3,CSNK2A1,MMP12,CA12,ALOX12,YES1,CISD1,HSD17B2,AHR,PSMB5,MET,TP53,XDH
Malignant neoplasms of biliary tract, distal bile duct
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C15
 CSNK2A3,ALOX5,NOX4,CSNK2A1,MMP12,ALOX12,CA4,HIF1A,CDK1,SRC,AKR1B1,LMNA,IGF1R,ESR2,AURKB,TP53
Hepatocellular carcinoma of liver
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12.02
 AKR1C3,MMP12,AURKB,NOX4,CYP19A1,CA12,CA4,CDK1,AKR1C3,MMP12,SRC,AURKB,CYP19A1,CA12,CDK1
Breast cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C60-2C6Y
 AXL,CYP19A1,SRC,CDK1,IGF1R,KDR,EGFR,CA4,MET,ESR2,MKNK1,CA12,MKNK2
 NCT00908791
Other specified malignant neoplasms of kidney, except renal pelvis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C90.Y
 ALOX5,AURKB,CYP19A1,CYP2C9,ACHE,MET,XDH,FFAR4,TYR,MMP12,ALOX5,AURKB,FFAR4
Malignant neoplasms of thymus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C27
 HSD17B10,CYP1B1,CYP2C9,FLT3,FFAR4,ALOX15,MMP12,DPP4,AKR1B1,CISD1,HSD17B2,ACHE,PSMB5
Malignant neoplasms of adrenal gland
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D11
 FFAR1,FABP3,MMP12,AURKB,NOX4,CYP19A1,CA12,DPP4,MET,CA4,CDK1,CA7,HSD17B2
Adenocarcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.0
 THPO,NPSR1,CYP2C9,CA7,TTR,AKR1C3,MMP12,CA12,AURKB,ACHE,CDK1,XDH
Hepatoblastoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12.01
 FABP3,IGF1R,MMP12,SRC,AKR1B1,AURKB,NOX4,CYP19A1,CA12,CA4,CDK1
Squamous cell carcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.2
 NPSR1,CYP2C9,CA7,AKR1C3,MMP12,CA12,ALOX12,HSD17B1,AURKB,CDK1,XDH
Malignant neoplasms of thyroid gland, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D10.Z
 FFAR1,MMP12,ALOX5,CYP1B1,NOX4,CA12,DPP4,MET,XDH,CA7
Parasitic worm infestation
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F90
 ACHE
Epidermal dysplasias
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EK90
 SRC
Dementia
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6D80-6D8Z
 ACHE
Oesophageal/gastroduodenal disorder
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD90
 ACHE
Phakomatoses/hamartoneoplastic syndrome
Disease Category: 20.Developmental anomalies
Disease ICD-11 Code: LD2D
 FLT3
Metabolic disorder
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C50-5D2Z
 DPP4
Acquired hypomelanotic disorder
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: ED63
 TYR
Transplanted organ/tissue
Disease Category: 24.Factors influencing health status or contact with health services
Disease ICD-11 Code: QB63
 FLT3
Pediculosis
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1G00
 ACHE
Myasthenia gravis
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C6Y
 ACHE
Unspecified viral infection of unspecified site
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D9Z
 FLT3
Bone/articular cartilage neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2F7B
 FLT3
Fungal infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F29-1F2F
 ALOX5
Diffuse large B-cell lymphoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A81
 FLT3
Diabetic foot ulcer
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD54
 EGFR
Carcinoid syndrome
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5B10
 ALOX5
Multiple structural anomalies syndrome
Disease Category: 20.Developmental anomalies
Disease ICD-11 Code: LD2F
 IGF1R
Ischaemic/haemorrhagic stroke
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8B20
 THPO
Heart failure
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD10-BD1Z
 XDH
Female pelvic pain
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA34
 AKR1C3
Sepsis
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1G40-1G41
 ESR2
Gout
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA25
 XDH
Colon cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B90
 EGFR
Encephalopathy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8E47
 XDH
Lip/oral cavity/pharynx neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B6E
 TP53
Prostate hyperplasia
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA90
 ESR2
Mild neurocognitive disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6D71
 ACHE
Thyrotoxicosis
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A02
 IGF1R
Transplant rejection
Disease Category: 22.Injury, poisoning or certain other consequences of external causes
Disease ICD-11 Code: NE84
 TP53
Metastatic digestive system neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D8Y
 SRC
Multiple sclerosis
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A40
 SRC
Endometriosis
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA10
 CYP19A1
Ovarian dysfunction
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A80
 TP53
Cardiomyopathy
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BC43
 TTR
Myotonic disorder
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C71
 GSK3B
Retinopathy
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9B71
 IGF1R
Menopausal disorder
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA30
 ESR2
Synovial sarcoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B5A
 SRC
Spinal cord/cranial nerve neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A02
 EGFR
Leiomyosarcoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B58
 SRC
Kidney failure
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GB60-GB6Z
 TP53
Cataract
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9B10
 AKR1B1
Intracerebral haemorrhage
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8B00
 EGFR
Unspecific substance harmful effect
Disease Category: 22.Injury, poisoning or certain other consequences of external causes
Disease ICD-11 Code: NE6Z
 ACHE
Fragile X chromosome
Disease Category: 20.Developmental anomalies
Disease ICD-11 Code: LD55
 GSK3B
Extraocular muscle disorder
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9C82
 IGF1R
Ureteral cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C92
 AHR
Chronic myelomonocytic leukaemia
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A40
 FLT3
Indeterminate colitis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD72
 ESR2
Human immunodeficiency virus disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1C60-1C62
 FLT3
Testicular cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C80
 EGFR
Amyloidosis
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5D00
 TTR
Substance abuse
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6C40
 ACHE
Acquired hypermelanosis
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: ED60
 TYR
Hyper-lipoproteinaemia
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C80
 ESR2
Mastocytosis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A21
 FLT3
Thrombosis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB61-GB90
 AKR1B1
Oesophagitis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA24
 CYP19A1
Angina pectoris
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA40
 EGFR
Metastatic malignant neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D50-2E09
 AXL
Metastatic biliary tract neoplasms
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C14-2C17
 EGFR
Esophageal cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B70
 TP53
Ischemic heart disease
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA40-BA6Z
 MET
Inflammatory arthropathy
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA2Z
 FLT3
Pulmonary hypertension
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BB01
 HIF1A
Autism spectrum disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A02
 DPP4
Metastatic liver/bile duct neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D80
 TP53
Malignant mesenchymal neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B5D-2B5Y
 EGFR
Hypopharyngeal cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B6D
 EGFR
Coronavirus infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D92
 CSNK2A1
Liver disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB90-DB9Z
 MET
Bladder cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C94
 TP53
Liposarcoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B59
 TP53
Vasomotor/allergic rhinitis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA08
 ESR2
Adrenomedullary hyperfunction
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A75
 HIF1A
Urethral cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C93
 EGFR
Mineral deficiency
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5B5K
 XDH
Diabetes mellitus, type unspecified
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A14
 DPP4
Biliary tract cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C17
 MET
Schizophrenia
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A20
 AKR1B1
Inborn purine/pyrimidine/nucleotide metabolism error
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C55
 XDH
Skin postprocedural disorder
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EL8Y
 EGFR
Irritable bowel syndrome
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD91
 ABCG2
Digestive organ benign neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2E92
 KDR
Filariasis
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F66
 ALOX5
Congenital aplastic anaemia
Disease Category: 03.Diseases of the blood or blood-forming organs
Disease ICD-11 Code: 3A70.0
 NCT01720147
Follicular lymphoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A80
 NCT00455416
Malignant neoplasms of other or unspecified parts of mouth
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B66
 NCT05456022
Neoplasms
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 02
 NCT00951158
Gastro-oesophageal reflux disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA22
 NCT02226484
Cystic fibrosis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA25
 NCT01348204
Macular degeneration
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9B75
 NCT05062486
Attention deficit hyperactivity disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A05
 NCT02558790
Lichen planus
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA91
 NCT01375101
Osteoarthritis
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA00-FA05
 NCT05276895
Chronic hepatitis C
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1E51.1
 NCT01438320
Unspecified malignant neoplasms of unspecified sites
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D4Z
 NCT04733534
Crohn disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD70
 MMP12
Idiopathic pulmonary fibrosis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CB03.4
 MMP12
Atrial fibrillation
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BC81.3
 CA7
Myotonic dystrophy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C71.0
 CYP1A1
Keratoconus
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9A78.50
 CA4
Pre-eclampsia
Disease Category: 18.Pregnancy, childbirth or the puerperium
Disease ICD-11 Code: JA24
 CA4
Systemic sclerosis
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A42
 NOX4
Dilated cardiomyopathy
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BC43.0
 ABCG2
Lyme borreliosis
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1C1G
 MET

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network 
Data Section
Select to Download
1. General Info & Plant Usage & Geographical Distribution  
2. Plant Ingredients  
3. Collective Molecular Proteins  
4. Collective Enriched Activities  
5. Plant molecular targets overlapping with DEGs  
6. Associated clinical trials  
7. Associated Human Diseases  
>> Targets derived from weak experimental activities
About Us

The CMAUP database is developed by the Bioinformatics & Drug Design group (BIDD) and School of Pharmacy, Fudan University.

CMAUP

Home

About

Browse

Help

Useful links

BIDD home

NPASS database

TCM-ID database

TTD database

Contact

826 Zhangheng Road, Pudong New District, Shanghai, China

Principle Investigator:
Prof. Chen Yu Zong
chenyuzong@sz.tsinghua.edu.cn
Prof. Zeng Xian
zengxian@fudan.edu.cn

Developer & Maintainer:
Ph.D. Student Dongyue Hou
dyhou22@m.fudan.edu.cn
Mr. Hanbo Lin
hblin19@fudan.edu.cn
Ms. Yuhan Feng
yhfeng22@m.fudan.edu.cn

© 2023 Copyright: Bioinformatics & Drug Design group