• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Tetradium Ruticarpum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTCTGCAGAGCAGAATGACCCGCGAACTAGTGAAAACACCGGTGGGGGCGTGCTTCGCGGCCGCTCCCCCTGCCCCCGTGGGTGCGGGACTCGTCCTGTTCCCCCCRGGGGCGACCAACTAACCCCCGGCGCGGACTGCGCCAAGGAAATCTAACGAGAGAGCACGCTCCCAGGGCACCGGACATGGTGATCCCCAGGATGCGGCGCCTTCTTTCACTTTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCTTTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTGCCCCACCCCCACCCCCACCCCGGGGGCCTGGCGGTGCCGGCGGATAATGGTCTCCCGTGCGCTCCCCGCTCGCGGTTGGCCCAAATTCGAGTCCTTGGCGACCGGAGCCGCGACAATCGGTGGTGAAAAGCCTCTCGAGCTCTAGTCGCGAGCCCGCGTCTCTGTTTCAGGACTCAGGGACCCTGATGCTCCGCGCAAGCGGTGCTCGCATCGCGACCCC

Click for details-----ITS1

GTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTCTGCAGAGCAGAATGACCCGCGAACTAGTGAAAACACCGGTGGGGGCGTGCTTCGCGGCCGCTCCCCCTGCCCCCGTGGGTGCGGGACTCGTCCTGTTCCCCCCRGGGGCGACCAACTAACCCCCGGCGCGGACTGCGCCAAGGAAATCTAACGAGAGAGCACGCTCCCAGGGCACCGGACATGGTGATCCCCAGGATGCGGCGCCTTCTTTCACTTTATCTATAA

Click for details-----ITS2

ATCGTTGCCCCACCCCCACCCCCACCCCGGGGGCCTGGCGGTGCSGGCGGATAATGGTCTCCCGTGCGCTCCCCGCTCGCGGTTGGCCCAAATTCGAGTCCTTGGCGACCGGAGCCGCGACAATCGGTGGTGAAAAGCCTCTCGAGCTCTAGTCGCGAGCCCGYGTCTCTGTTTCAGGACTCAGGGACCCTGATGCTCCGCGCAAGCGGTGCTCGCATCGCGACCCCAGGTC
Taxonomic Information

Plant ID: NPO19935
Plant Latin Name: Tetradium Ruticarpum
Taxonomy Genus: Tetradium
Taxonomy Family: Rutaceae

Plant External Links:

NCBI TaxonomyDB: 354523
Plant-of-the-World-Online: 909759-1

Used in Medicines

Country/Region:
India

Traditional Medicine System:
Indian Folk

Geographical Distribution

India; South Africa

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

206 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


143 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

89 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC97804

Ingredient ID: NPC97541

Ingredient ID: NPC94670

Ingredient ID: NPC93726

Ingredient ID: NPC92828

Ingredient ID: NPC92676

Ingredient ID: NPC92111

Ingredient ID: NPC87164

Ingredient ID: NPC86683

Ingredient ID: NPC86013

Ingredient ID: NPC84429

Ingredient ID: NPC78551

Ingredient ID: NPC76773

Ingredient ID: NPC76145

Ingredient ID: NPC7579

Ingredient ID: NPC73249

Ingredient ID: NPC71703

Ingredient ID: NPC70453

Ingredient ID: NPC69109

Ingredient ID: NPC68889

Ingredient ID: NPC66577

Ingredient ID: NPC65624

Ingredient ID: NPC64176

Ingredient ID: NPC61828

Ingredient ID: NPC6150

Ingredient ID: NPC61186

Ingredient ID: NPC60556

Ingredient ID: NPC60553

Ingredient ID: NPC60288

Ingredient ID: NPC59040

Ingredient ID: NPC57877

Ingredient ID: NPC55023

Ingredient ID: NPC54947

Ingredient ID: NPC52238

Ingredient ID: NPC51700

Ingredient ID: NPC5167

Ingredient ID: NPC50103

Ingredient ID: NPC4826

Ingredient ID: NPC482447

Ingredient ID: NPC482446

Ingredient ID: NPC482445

Ingredient ID: NPC47267

Ingredient ID: NPC45727

Ingredient ID: NPC37947

Ingredient ID: NPC37029

Ingredient ID: NPC36408

Ingredient ID: NPC34764

Ingredient ID: NPC34485

Ingredient ID: NPC3318

Ingredient ID: NPC313650

Ingredient ID: NPC312929

Ingredient ID: NPC309182

Ingredient ID: NPC306411

Ingredient ID: NPC305332

Ingredient ID: NPC305016

Ingredient ID: NPC302754

Ingredient ID: NPC300574

Ingredient ID: NPC300282

Ingredient ID: NPC299576

Ingredient ID: NPC299539

Ingredient ID: NPC296643

Ingredient ID: NPC295317

Ingredient ID: NPC294815

Ingredient ID: NPC294136

Ingredient ID: NPC291962

Ingredient ID: NPC291847

Ingredient ID: NPC290859

Ingredient ID: NPC290613

Ingredient ID: NPC29

Ingredient ID: NPC289883

Ingredient ID: NPC289366

Ingredient ID: NPC289145

Ingredient ID: NPC288537

Ingredient ID: NPC287297

Ingredient ID: NPC286735

Ingredient ID: NPC282923

Ingredient ID: NPC282715

Ingredient ID: NPC281278

Ingredient ID: NPC281035

Ingredient ID: NPC273454

Ingredient ID: NPC27208

Ingredient ID: NPC269862

Ingredient ID: NPC26974

Ingredient ID: NPC26906

Ingredient ID: NPC268862

Ingredient ID: NPC266636

Ingredient ID: NPC264711

Ingredient ID: NPC264145

Ingredient ID: NPC262789

Ingredient ID: NPC259874

Ingredient ID: NPC259733

Ingredient ID: NPC258531

Ingredient ID: NPC25810

Ingredient ID: NPC258000

Ingredient ID: NPC256849

Ingredient ID: NPC255662

Ingredient ID: NPC254847

Ingredient ID: NPC248121

Ingredient ID: NPC247803

Ingredient ID: NPC243728

Ingredient ID: NPC243725

Ingredient ID: NPC238874

Ingredient ID: NPC237951

Ingredient ID: NPC236495

Ingredient ID: NPC234364

Ingredient ID: NPC232779

Ingredient ID: NPC232375

Ingredient ID: NPC231738

Ingredient ID: NPC230786

Ingredient ID: NPC230301

Ingredient ID: NPC229235

Ingredient ID: NPC22832

Ingredient ID: NPC226579

Ingredient ID: NPC226087

Ingredient ID: NPC22390

Ingredient ID: NPC223249

Ingredient ID: NPC223067

Ingredient ID: NPC221812

Ingredient ID: NPC220210

Ingredient ID: NPC220035

Ingredient ID: NPC218793

Ingredient ID: NPC218109

Ingredient ID: NPC215894

Ingredient ID: NPC214584

Ingredient ID: NPC21429

Ingredient ID: NPC213

Ingredient ID: NPC211913

Ingredient ID: NPC209296

Ingredient ID: NPC209275

Ingredient ID: NPC20791

Ingredient ID: NPC207695

Ingredient ID: NPC202666

Ingredient ID: NPC202549

Ingredient ID: NPC202399

Ingredient ID: NPC20181

Ingredient ID: NPC20082

Ingredient ID: NPC200014

Ingredient ID: NPC198658

Ingredient ID: NPC198577

Ingredient ID: NPC197598

Ingredient ID: NPC197316

Ingredient ID: NPC19429

Ingredient ID: NPC193793

Ingredient ID: NPC192063

Ingredient ID: NPC190928

Ingredient ID: NPC190810

Ingredient ID: NPC189908

Ingredient ID: NPC189646

Ingredient ID: NPC188693

Ingredient ID: NPC186908

Ingredient ID: NPC180871

Ingredient ID: NPC180118

Ingredient ID: NPC175987

Ingredient ID: NPC173651

Ingredient ID: NPC173627

Ingredient ID: NPC17273

Ingredient ID: NPC170170

Ingredient ID: NPC169398

Ingredient ID: NPC164958

Ingredient ID: NPC16464

Ingredient ID: NPC16435

Ingredient ID: NPC161956

Ingredient ID: NPC160851

Ingredient ID: NPC15912

Ingredient ID: NPC157338

Ingredient ID: NPC156461

Ingredient ID: NPC155297

Ingredient ID: NPC152178

Ingredient ID: NPC149571

Ingredient ID: NPC144023

Ingredient ID: NPC142415

Ingredient ID: NPC141612

Ingredient ID: NPC13991

Ingredient ID: NPC13986

Ingredient ID: NPC139546

Ingredient ID: NPC138942

Ingredient ID: NPC138770

Ingredient ID: NPC138113

Ingredient ID: NPC13730

Ingredient ID: NPC135601

Ingredient ID: NPC133003

Ingredient ID: NPC131769

Ingredient ID: NPC130199

Ingredient ID: NPC129472

Ingredient ID: NPC127846

Ingredient ID: NPC122318

Ingredient ID: NPC120840

Ingredient ID: NPC119979

Ingredient ID: NPC117460

Ingredient ID: NPC11743

Ingredient ID: NPC117032

Ingredient ID: NPC116034

Ingredient ID: NPC114239

Ingredient ID: NPC114011

Ingredient ID: NPC112623

Ingredient ID: NPC112609

Ingredient ID: NPC112373

Ingredient ID: NPC11173

Ingredient ID: NPC111628

Ingredient ID: NPC110556

Ingredient ID: NPC109813

Ingredient ID: NPC107122

Ingredient ID: NPC103264

Ingredient ID: NPC101917

Ingredient ID: NPC101712

Ingredient ID: NPC101686