• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Emilia Sonchifolia


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TGTCCTCCTTCCATCTCTATACCGCGAGAGAGATACAGCTGTACCACGGAGATAGGCATTGTGAATGTAGTAACAACATTTTGGTGTCCTTGGTATCAGTCATGTCATTTGTCTGATTATTTGGATGCAATGTTGATGTGTATCTTTGGTAAACCCGTTGGGTGCCAATGATTTTACATTGACAAAACAACAACCATCGACACGGCACGTGTCAAGGAAAAATGAACATAAGAGCGCTTGTACCATGCTTTCATCGTTCGCGGTTATTGCAGGGTATCTTGCATCTTTATAAAATAAACGACTCTCGACAACGGATATCTTGGCCCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGTCCGAAACCTTTTGGTCGAGGACACGTCTGCCTGGGCGTCACATGTCATGTCACCTCCCAACACACCTCCCGATGGAGATGTCATTGTGGTGGTGGAGATTGGCTTTCCGTTCCAGAGGCGCGGTTAGCCAAAATAAGACTCCCTTTTTATTGACACACGATTAGTGGTGGTCGAAAAGCCCTCTTCTCGAGTCGTGTGTTCAAATTATTTAAGAGGAACTCATTGATGACCCTAATGTCTCGTCTTGTACGAAGCATTGA

Click for details-----ITS1

TGTCCTCCTTCCATCTCTATACCGCGAGAGAGATACAGCTGTACCACGGAGATAGGCATTGTGAATGTAGTAACAACATTTTGGTGTCCTTGGTATCAGTCATGTCATTTGTCTGATTATTTGGATGCAATGTTGATGTGTATCTTTGGTAAACCCGTTGGGTGCCAATGATTTTACATTGACAAAACAACAACCATCGACACGGCACGTGTCAAGGAAAAATGAACATAAGAGCGCTTGTACCATGCTTTCATCGTTCGCGGTTATTGCAGGGTATCTTGCATCTTTATAAAATAAA

Click for details-----ITS2

GTCATGTCACCTCCTAACACACCTCCTGATGGAGATGTCATTGTTGTGGTGGAGATTGGCTTTCCGTTCCAGAGGCGCGGTTAGCTAAAATAGGAGTCCTCTTTTATTGACACACGATTAGTGGTGGTCGAAAAGCCCTCTTCTCGAGTTGTGTGTTCAAATTATTTAAGAGGAACTCATTGATGACCCTAATGTCTCGTCTTGTACGAAGCGTTGATT
Taxonomic Information

Plant ID: NPO19901
Plant Latin Name: Emilia Sonchifolia
Taxonomy Genus: Emilia
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: 415160
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Thailand; Indonesia; India; China

Traditional Medicine System:
Indian Folk; TCM; Ayurveda; Siddha


Medicinal Functions:

Astringent; Depurative; Diaphoretic; Diuretic; Expectorant; Febrifuge; Odontalgic; Ophthalmic

Geographical Distribution

India; Indonesia; China; Thailand

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

90 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


37 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

22 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC90841

Ingredient ID: NPC90226

Ingredient ID: NPC86789

Ingredient ID: NPC86496

Ingredient ID: NPC78159

Ingredient ID: NPC74910

Ingredient ID: NPC73418

Ingredient ID: NPC71283

Ingredient ID: NPC65840

Ingredient ID: NPC62049

Ingredient ID: NPC59650

Ingredient ID: NPC51939

Ingredient ID: NPC48057

Ingredient ID: NPC46864

Ingredient ID: NPC43094

Ingredient ID: NPC41029

Ingredient ID: NPC40592

Ingredient ID: NPC39822

Ingredient ID: NPC37623

Ingredient ID: NPC34808

Ingredient ID: NPC31991

Ingredient ID: NPC317201

Ingredient ID: NPC31494

Ingredient ID: NPC307792

Ingredient ID: NPC307131

Ingredient ID: NPC301470

Ingredient ID: NPC300059

Ingredient ID: NPC299475

Ingredient ID: NPC297581

Ingredient ID: NPC29224

Ingredient ID: NPC278153

Ingredient ID: NPC271150

Ingredient ID: NPC265662

Ingredient ID: NPC261153

Ingredient ID: NPC259688

Ingredient ID: NPC257668

Ingredient ID: NPC257640

Ingredient ID: NPC257194

Ingredient ID: NPC256892

Ingredient ID: NPC249967

Ingredient ID: NPC245390

Ingredient ID: NPC244543

Ingredient ID: NPC242930

Ingredient ID: NPC242428

Ingredient ID: NPC241279

Ingredient ID: NPC235080

Ingredient ID: NPC233832

Ingredient ID: NPC228039

Ingredient ID: NPC226453

Ingredient ID: NPC223059

Ingredient ID: NPC222618

Ingredient ID: NPC22228

Ingredient ID: NPC219397

Ingredient ID: NPC216199

Ingredient ID: NPC208949

Ingredient ID: NPC208573

Ingredient ID: NPC206510

Ingredient ID: NPC205926

Ingredient ID: NPC20589

Ingredient ID: NPC200246

Ingredient ID: NPC200061

Ingredient ID: NPC194883

Ingredient ID: NPC18928

Ingredient ID: NPC189079

Ingredient ID: NPC187648

Ingredient ID: NPC18603

Ingredient ID: NPC183927

Ingredient ID: NPC182238

Ingredient ID: NPC178212

Ingredient ID: NPC17810

Ingredient ID: NPC178085

Ingredient ID: NPC174146

Ingredient ID: NPC170427

Ingredient ID: NPC15636

Ingredient ID: NPC154213

Ingredient ID: NPC153923

Ingredient ID: NPC147092

Ingredient ID: NPC146795

Ingredient ID: NPC143726

Ingredient ID: NPC133609

Ingredient ID: NPC131486

Ingredient ID: NPC129226

Ingredient ID: NPC128828

Ingredient ID: NPC127508

Ingredient ID: NPC124598

Ingredient ID: NPC122752

Ingredient ID: NPC114685

Ingredient ID: NPC110406

Ingredient ID: NPC103518

Ingredient ID: NPC103483