• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Forsythia Viridissima


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TGTCGAAACCTGCAAAGCAGACCCGCGAACATGTTTTAAAACACACGGGAGGATGACGATGGTGCAGCCACCGCGCTGTCCCTCGTCGGAGCCCCGCTCCGTCGACGTGCGCATTCACTGCGTCCGTCGCATGGACTAACGAACCCCGGCGCGGAATGCGCCAAGGAATACTCCACAACATTGCCCGTCCCCAGATGCCCCGTTCGCGGTGTGTGTCTGGGGACTTGAGGCGTGTCTTGAATCTAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGCAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTATGCTGAGGGCACGTCTGCCTGGGCGTCACGCATCTCGTCGCCCTCCACCTCCTCCCGAAAGGGATTCGTGGGGTGTTGGGTTGGATATTGGCCTCCCGTGCGCCCTCGTGCGCGGCTGGCTTAAATTTGATTCGGCATCGACGTATGTCACGACAATTGGTGGTTGAAGACCTCAACTTGCGTGTTGTCGTGCAAGGCTGCGTCGTTTTGATCGGATGTTTTGACCCCAAGGTGCTTTTGCACTTCGACAGCGACCACAGGTCAGGCGGGATTACCAG

Click for details-----ITS1

TGTCGAAACCTGCAAAGCAGACCCGCGAACATGTTTTAAAACACACGGGAGGATGACGATGGTGCAGCCACCGCGCTGTCCCTCGTCGGAGCCCCGCTCCGTCGACGTGCGCATTCACTGCGTCCGTCGCATGGACTAACGAACCCCGGCGCGGAATGCGCCAAGGAATACTCCACAACATTGCCCGTCCCCAGATGCCCCGTTCGCGGTGTGTGTCTGGGGACTTGAGGCGTGTCTTGAATCTAAAA

Click for details-----ITS2

ATCTCGTCGCCCTCCACCTCCCCCCGAAAGGGATTCGTGGGGTGTTGGGTTGGATATTGGCCTCCCGTGCGCCCTCGTGCGCGGCTGGCCTAAATTTGATTCGGCATCGACGTATGTCACGACAATTGGTGGTTGAAGACCTCAACTTGCGTGTTGTCGTGCAAGGCTGCGTCGTTTTGATCGGATGTTTTGACCCCAAGGTGCTTTTGCACTTCGACAGCGACCCCAGGTCAGGCGG
Taxonomic Information

Plant ID: NPO19805
Plant Latin Name: Forsythia Viridissima
Taxonomy Genus: Forsythia
Taxonomy Family: Oleaceae

Plant External Links:

NCBI TaxonomyDB: 205691
Plant-of-the-World-Online: 608903-1

Used in Medicines

Country/Region:
South Korea; China

Traditional Medicine System:
TCM


Medicinal Functions:

Antibacterial; Antifungal; Antispasmodic; Emmenagogue

Geographical Distribution

United States; Japan; South Korea; China; South Africa

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

153 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


103 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

99 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC96769

Ingredient ID: NPC93211

Ingredient ID: NPC88789

Ingredient ID: NPC88085

Ingredient ID: NPC84868

Ingredient ID: NPC81515

Ingredient ID: NPC79056

Ingredient ID: NPC78551

Ingredient ID: NPC76145

Ingredient ID: NPC75161

Ingredient ID: NPC75121

Ingredient ID: NPC71853

Ingredient ID: NPC71703

Ingredient ID: NPC71506

Ingredient ID: NPC70744

Ingredient ID: NPC68889

Ingredient ID: NPC68779

Ingredient ID: NPC65606

Ingredient ID: NPC64176

Ingredient ID: NPC62829

Ingredient ID: NPC62765

Ingredient ID: NPC61604

Ingredient ID: NPC52472

Ingredient ID: NPC51758

Ingredient ID: NPC51700

Ingredient ID: NPC51400

Ingredient ID: NPC4982

Ingredient ID: NPC4826

Ingredient ID: NPC478705

Ingredient ID: NPC478704

Ingredient ID: NPC478703

Ingredient ID: NPC478702

Ingredient ID: NPC478701

Ingredient ID: NPC478700

Ingredient ID: NPC45844

Ingredient ID: NPC45727

Ingredient ID: NPC44751

Ingredient ID: NPC44328

Ingredient ID: NPC42503

Ingredient ID: NPC40432

Ingredient ID: NPC40249

Ingredient ID: NPC3649

Ingredient ID: NPC34764

Ingredient ID: NPC3295

Ingredient ID: NPC311987

Ingredient ID: NPC307050

Ingredient ID: NPC302857

Ingredient ID: NPC301161

Ingredient ID: NPC300894

Ingredient ID: NPC300776

Ingredient ID: NPC300017

Ingredient ID: NPC299706

Ingredient ID: NPC29883

Ingredient ID: NPC296337

Ingredient ID: NPC296108

Ingredient ID: NPC294902

Ingredient ID: NPC290613

Ingredient ID: NPC29

Ingredient ID: NPC288537

Ingredient ID: NPC287660

Ingredient ID: NPC285776

Ingredient ID: NPC281131

Ingredient ID: NPC27843

Ingredient ID: NPC278102

Ingredient ID: NPC276753

Ingredient ID: NPC27184

Ingredient ID: NPC26906

Ingredient ID: NPC264910

Ingredient ID: NPC264711

Ingredient ID: NPC264317

Ingredient ID: NPC264125

Ingredient ID: NPC262789

Ingredient ID: NPC260425

Ingredient ID: NPC255662

Ingredient ID: NPC252821

Ingredient ID: NPC252558

Ingredient ID: NPC251666

Ingredient ID: NPC249281

Ingredient ID: NPC246947

Ingredient ID: NPC246287

Ingredient ID: NPC246255

Ingredient ID: NPC246165

Ingredient ID: NPC239039

Ingredient ID: NPC23845

Ingredient ID: NPC232375

Ingredient ID: NPC23188

Ingredient ID: NPC230301

Ingredient ID: NPC229882

Ingredient ID: NPC228346

Ingredient ID: NPC227670

Ingredient ID: NPC227168

Ingredient ID: NPC22229

Ingredient ID: NPC22150

Ingredient ID: NPC216630

Ingredient ID: NPC216385

Ingredient ID: NPC215632

Ingredient ID: NPC215089

Ingredient ID: NPC214584

Ingredient ID: NPC213749

Ingredient ID: NPC209970

Ingredient ID: NPC208616

Ingredient ID: NPC20791

Ingredient ID: NPC205673

Ingredient ID: NPC200903

Ingredient ID: NPC200210

Ingredient ID: NPC199046

Ingredient ID: NPC198658

Ingredient ID: NPC197396

Ingredient ID: NPC197316

Ingredient ID: NPC196983

Ingredient ID: NPC190810

Ingredient ID: NPC189262

Ingredient ID: NPC188238

Ingredient ID: NPC180871

Ingredient ID: NPC179950

Ingredient ID: NPC177112

Ingredient ID: NPC176814

Ingredient ID: NPC176740

Ingredient ID: NPC175955

Ingredient ID: NPC173996

Ingredient ID: NPC168855

Ingredient ID: NPC167976

Ingredient ID: NPC166442

Ingredient ID: NPC166362

Ingredient ID: NPC161557

Ingredient ID: NPC16070

Ingredient ID: NPC158079

Ingredient ID: NPC157338

Ingredient ID: NPC145038

Ingredient ID: NPC144023

Ingredient ID: NPC142415

Ingredient ID: NPC141777

Ingredient ID: NPC13991

Ingredient ID: NPC139546

Ingredient ID: NPC138113

Ingredient ID: NPC137949

Ingredient ID: NPC135088

Ingredient ID: NPC131981

Ingredient ID: NPC125062

Ingredient ID: NPC12278

Ingredient ID: NPC120840

Ingredient ID: NPC11719

Ingredient ID: NPC115207

Ingredient ID: NPC114239

Ingredient ID: NPC113733

Ingredient ID: NPC111888

Ingredient ID: NPC110942

Ingredient ID: NPC110899

Ingredient ID: NPC108598

Ingredient ID: NPC1075

Ingredient ID: NPC105585

Ingredient ID: NPC102091

Ingredient ID: NPC101594