CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Populus Tomentosa

Example Image

PLANiTS DNA barcode

ATYGTCGCCCCCTCTCCCCTCGGCTCGCGAGGGCGGGGGCGGATACTGGTCTCCCGCGCGCTCCCGCTCGYGGTTGGCCCAAAATCGAGTCCTCGGCGACGGTCGCCACGACGAGCGGTGGTTGAGAGACCCTCGGACACGGTCGTGCGCGCGCCTGTCGCCCCCGGGATCTCCTGGACCCTCGGGCATCGAAWTTCTAGGATGCTCTCG

Taxonomic Information

Plant ID: NPO19792
Plant Latin Name: Populus Tomentosa
Taxonomy Genus: Populus
Taxonomy Family: Salicaceae

Plant External Links:

NCBI TaxonomyDB: 118781
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:

China

Traditional Medicine System:

TCM

Geographical Distribution

China

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

36 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

28 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)