• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Citrus Sinensis


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TGTCGACCTGCCAGCAGACGACCCGCGAACCAGTTGATATCACCGGCGGCGGGAGGGGGGGCGCGTCCGCAACGGGCGCTCCTCCTTCCCGCCCCACGCCGCGGGGAGAGGGACTCGTCCCGCTCCCGGCTGGCGAAACAACGAACCCCCGGCGCGGACTGCGCCAAGGAAATCTAACGAGAGAGCACGCTCCCGCGGCCCCGGAGACGGTGCGCCGCGGGGTGCGGCGCCTTCTTTCACATGTATCCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTGCCCCACCCCACCCCCCCAAACCAAGGCGGGGGCCCCGGGGTGCGGGCGGAGATTGGCCTCCCGTGCGCTGACCGCTCGCGGTTGGCCCAAATATGAGTCCTCGGCGACCGAAGCCGCGGCGATCGGTGGTGAAACAAAAGCTTCTCTAGTTCCGGCGCCGGGCCCGGCTTCCAATGGGGAATCTGGCAGCCTTGAGCTTCCCGCAAGGCGCGCTTGGATTGGCAACCCCAGTCCAGGGGGAATACCCCGTTAATTTTAGCCTATAAAAGGGGAAAAAAAA

Click for details-----ITS1

GGATCATGGTCAAAACCTGCCCAGCAGAACGACCCGCGAACCAGTTGATATCACCGGCGGCGGGAGGGGGKGCGCGTAAGCCACGGGCGCTCCTCCTTCCCGCCCCATGCCGCGGGGAGAGGGACTCGTCCCGCTCCYGGCTGGCGAAACAACGAACCCCCGGCGCGGACTGCGCCAAGGAAATCTAACGAGAGAGCACGCTCCCGCGGCCCCGGAGACGGTGCGCYGCGGGGTGCGGCGCCTTCTTTCACATGTATCCAAAA

Click for details-----ITS2

ATCGTTGCCCCACCCCACCCCCCCAAACCAAGGCGGGGGCCCCGGGGTGCGGGCGGAGATTGGCCTCCCGTGCGCTGACCGCTCGCGGTTGGCCCAAATATGAGTCCTCGGCGACCGAAGCCGCGGCGATCGGTGGTGAAACAAAAGCTTCTCTAGTTCCGGCGCCGGGCCCGGCTTCCAATGGGGAATCTGGCAGCCTTGAGCTTCCCGCAAGGCGCGCTTGGATTGGCAACCCCAGTCCAGGGGGAATACCCCGTTAATTTTAGCCTATAAAAGGGGAAAAAAAA
Taxonomic Information

Plant ID: NPO19787
Plant Latin Name: Citrus Sinensis
Taxonomy Genus: Citrus
Taxonomy Family: Rutaceae

Plant External Links:

NCBI TaxonomyDB: 2711
Plant-of-the-World-Online: 551142-1

Used in Medicines

Country/Region:
Brazil; Italy; Portugal; India; Burkina Faso; Togo; China; Argentina; Nigeria

Traditional Medicine System:
Indian Folk; TCM; Ayurveda; Siddha


Medicinal Functions:

Appetizer; Blood purifier; Carminative; Miscellany; Skin; Tonic

Geographical Distribution

Brazil; Liberia; Angola; Portugal; Guinea; Italy; Nigeria; India; Cote d'Ivoire; Togo; Rwanda; China; Gabon; Argentina; Cameroon; Burkina Faso; Benin

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

356 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


254 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

184 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99734

Ingredient ID: NPC98307

Ingredient ID: NPC97285

Ingredient ID: NPC96343

Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC91383

Ingredient ID: NPC89088

Ingredient ID: NPC88839

Ingredient ID: NPC88566

Ingredient ID: NPC86655

Ingredient ID: NPC85813

Ingredient ID: NPC85233

Ingredient ID: NPC83604

Ingredient ID: NPC81010

Ingredient ID: NPC79943

Ingredient ID: NPC79858

Ingredient ID: NPC79056

Ingredient ID: NPC78551

Ingredient ID: NPC77916

Ingredient ID: NPC76145

Ingredient ID: NPC75236

Ingredient ID: NPC75121

Ingredient ID: NPC75110

Ingredient ID: NPC74859

Ingredient ID: NPC725

Ingredient ID: NPC72285

Ingredient ID: NPC71703

Ingredient ID: NPC71506

Ingredient ID: NPC70206

Ingredient ID: NPC69445

Ingredient ID: NPC68889

Ingredient ID: NPC68271

Ingredient ID: NPC66430

Ingredient ID: NPC65985

Ingredient ID: NPC65517

Ingredient ID: NPC64176

Ingredient ID: NPC62045

Ingredient ID: NPC61828

Ingredient ID: NPC60556

Ingredient ID: NPC60288

Ingredient ID: NPC60151

Ingredient ID: NPC59650

Ingredient ID: NPC59581

Ingredient ID: NPC58970

Ingredient ID: NPC58957

Ingredient ID: NPC5893

Ingredient ID: NPC55412

Ingredient ID: NPC5447

Ingredient ID: NPC54341

Ingredient ID: NPC53809

Ingredient ID: NPC51189

Ingredient ID: NPC50316

Ingredient ID: NPC49151

Ingredient ID: NPC491218

Ingredient ID: NPC490449

Ingredient ID: NPC490436

Ingredient ID: NPC490432

Ingredient ID: NPC490427

Ingredient ID: NPC490424

Ingredient ID: NPC490395

Ingredient ID: NPC490162

Ingredient ID: NPC490028

Ingredient ID: NPC490025

Ingredient ID: NPC489969

Ingredient ID: NPC489966

Ingredient ID: NPC489965

Ingredient ID: NPC489958

Ingredient ID: NPC489953

Ingredient ID: NPC489907

Ingredient ID: NPC48637

Ingredient ID: NPC46705

Ingredient ID: NPC45782

Ingredient ID: NPC45727

Ingredient ID: NPC44376

Ingredient ID: NPC44328

Ingredient ID: NPC43587

Ingredient ID: NPC43114

Ingredient ID: NPC424

Ingredient ID: NPC41180

Ingredient ID: NPC40818

Ingredient ID: NPC39426

Ingredient ID: NPC39068

Ingredient ID: NPC3649

Ingredient ID: NPC36408

Ingredient ID: NPC36108

Ingredient ID: NPC34908

Ingredient ID: NPC34764

Ingredient ID: NPC331113

Ingredient ID: NPC330773

Ingredient ID: NPC328725

Ingredient ID: NPC328700

Ingredient ID: NPC328447

Ingredient ID: NPC326113

Ingredient ID: NPC32441

Ingredient ID: NPC32279

Ingredient ID: NPC317120

Ingredient ID: NPC313955

Ingredient ID: NPC313179

Ingredient ID: NPC31279

Ingredient ID: NPC312132

Ingredient ID: NPC311485

Ingredient ID: NPC309182

Ingredient ID: NPC30853

Ingredient ID: NPC308108

Ingredient ID: NPC306296

Ingredient ID: NPC305759

Ingredient ID: NPC305016

Ingredient ID: NPC303979

Ingredient ID: NPC302950

Ingredient ID: NPC302556

Ingredient ID: NPC300649

Ingredient ID: NPC300326

Ingredient ID: NPC29988

Ingredient ID: NPC296020

Ingredient ID: NPC294902

Ingredient ID: NPC294548

Ingredient ID: NPC293378

Ingredient ID: NPC291886

Ingredient ID: NPC291124

Ingredient ID: NPC290613

Ingredient ID: NPC2905

Ingredient ID: NPC290319

Ingredient ID: NPC290189

Ingredient ID: NPC29

Ingredient ID: NPC288932

Ingredient ID: NPC287660

Ingredient ID: NPC287349

Ingredient ID: NPC287331

Ingredient ID: NPC283682

Ingredient ID: NPC28246

Ingredient ID: NPC281686

Ingredient ID: NPC281664

Ingredient ID: NPC281457

Ingredient ID: NPC279865

Ingredient ID: NPC279121

Ingredient ID: NPC279026

Ingredient ID: NPC276009

Ingredient ID: NPC275706

Ingredient ID: NPC275462

Ingredient ID: NPC272614

Ingredient ID: NPC2724

Ingredient ID: NPC272085

Ingredient ID: NPC271270

Ingredient ID: NPC269980

Ingredient ID: NPC269919

Ingredient ID: NPC26906

Ingredient ID: NPC26600

Ingredient ID: NPC2660

Ingredient ID: NPC26590

Ingredient ID: NPC265305

Ingredient ID: NPC262505

Ingredient ID: NPC261831

Ingredient ID: NPC261718

Ingredient ID: NPC259058

Ingredient ID: NPC25810

Ingredient ID: NPC257188

Ingredient ID: NPC257090

Ingredient ID: NPC255042

Ingredient ID: NPC254713

Ingredient ID: NPC251666

Ingredient ID: NPC250828

Ingredient ID: NPC249048

Ingredient ID: NPC248726

Ingredient ID: NPC248681

Ingredient ID: NPC24824

Ingredient ID: NPC247553

Ingredient ID: NPC246469

Ingredient ID: NPC246165

Ingredient ID: NPC243509

Ingredient ID: NPC242580

Ingredient ID: NPC240722

Ingredient ID: NPC240328

Ingredient ID: NPC237965

Ingredient ID: NPC237812

Ingredient ID: NPC236726

Ingredient ID: NPC236602

Ingredient ID: NPC23508

Ingredient ID: NPC233731

Ingredient ID: NPC233169

Ingredient ID: NPC232375

Ingredient ID: NPC231738

Ingredient ID: NPC23114

Ingredient ID: NPC231047

Ingredient ID: NPC230573

Ingredient ID: NPC230301

Ingredient ID: NPC229851

Ingredient ID: NPC228198

Ingredient ID: NPC226453

Ingredient ID: NPC226027

Ingredient ID: NPC225783

Ingredient ID: NPC22229

Ingredient ID: NPC22098

Ingredient ID: NPC219143

Ingredient ID: NPC218918

Ingredient ID: NPC215932

Ingredient ID: NPC215632

Ingredient ID: NPC215012

Ingredient ID: NPC214909

Ingredient ID: NPC214584

Ingredient ID: NPC214285

Ingredient ID: NPC213918

Ingredient ID: NPC213876

Ingredient ID: NPC213749

Ingredient ID: NPC213

Ingredient ID: NPC211960

Ingredient ID: NPC210316

Ingredient ID: NPC209275

Ingredient ID: NPC208793

Ingredient ID: NPC20791

Ingredient ID: NPC203468

Ingredient ID: NPC202977

Ingredient ID: NPC202771

Ingredient ID: NPC201844

Ingredient ID: NPC201547

Ingredient ID: NPC201284

Ingredient ID: NPC19973

Ingredient ID: NPC199072

Ingredient ID: NPC198743

Ingredient ID: NPC198658

Ingredient ID: NPC197942

Ingredient ID: NPC197122

Ingredient ID: NPC197087

Ingredient ID: NPC196442

Ingredient ID: NPC19560

Ingredient ID: NPC195246

Ingredient ID: NPC194084

Ingredient ID: NPC19354

Ingredient ID: NPC192402

Ingredient ID: NPC190810

Ingredient ID: NPC190771

Ingredient ID: NPC190270

Ingredient ID: NPC189436

Ingredient ID: NPC188238

Ingredient ID: NPC18781

Ingredient ID: NPC187770

Ingredient ID: NPC185755

Ingredient ID: NPC18507

Ingredient ID: NPC183923

Ingredient ID: NPC182842

Ingredient ID: NPC182840

Ingredient ID: NPC182158

Ingredient ID: NPC18205

Ingredient ID: NPC180871

Ingredient ID: NPC180006

Ingredient ID: NPC179831

Ingredient ID: NPC179396

Ingredient ID: NPC17810

Ingredient ID: NPC177771

Ingredient ID: NPC177731

Ingredient ID: NPC177112

Ingredient ID: NPC176819

Ingredient ID: NPC176548

Ingredient ID: NPC175987

Ingredient ID: NPC174246

Ingredient ID: NPC173760

Ingredient ID: NPC172833

Ingredient ID: NPC17248

Ingredient ID: NPC171280

Ingredient ID: NPC171148

Ingredient ID: NPC169786

Ingredient ID: NPC169749

Ingredient ID: NPC169631

Ingredient ID: NPC168579

Ingredient ID: NPC168351

Ingredient ID: NPC1682

Ingredient ID: NPC167400

Ingredient ID: NPC166692

Ingredient ID: NPC166018

Ingredient ID: NPC165651

Ingredient ID: NPC1656

Ingredient ID: NPC165208

Ingredient ID: NPC164721

Ingredient ID: NPC163984

Ingredient ID: NPC163556

Ingredient ID: NPC163175

Ingredient ID: NPC162822

Ingredient ID: NPC160683

Ingredient ID: NPC156882

Ingredient ID: NPC15573

Ingredient ID: NPC15529

Ingredient ID: NPC155182

Ingredient ID: NPC154650

Ingredient ID: NPC154466

Ingredient ID: NPC154409

Ingredient ID: NPC154176

Ingredient ID: NPC152538

Ingredient ID: NPC152451

Ingredient ID: NPC150950

Ingredient ID: NPC14958

Ingredient ID: NPC14949

Ingredient ID: NPC149006

Ingredient ID: NPC148391

Ingredient ID: NPC148303

Ingredient ID: NPC147983

Ingredient ID: NPC147086

Ingredient ID: NPC146289

Ingredient ID: NPC145708

Ingredient ID: NPC145638

Ingredient ID: NPC145373

Ingredient ID: NPC144855

Ingredient ID: NPC144023

Ingredient ID: NPC143778

Ingredient ID: NPC143211

Ingredient ID: NPC142951

Ingredient ID: NPC142860

Ingredient ID: NPC141078

Ingredient ID: NPC13991

Ingredient ID: NPC139546

Ingredient ID: NPC138932

Ingredient ID: NPC138572

Ingredient ID: NPC138113

Ingredient ID: NPC137958

Ingredient ID: NPC137949

Ingredient ID: NPC137816

Ingredient ID: NPC13619

Ingredient ID: NPC136014

Ingredient ID: NPC135353

Ingredient ID: NPC13428

Ingredient ID: NPC133360

Ingredient ID: NPC131431

Ingredient ID: NPC131157

Ingredient ID: NPC130683

Ingredient ID: NPC129999

Ingredient ID: NPC129180

Ingredient ID: NPC127102

Ingredient ID: NPC126681

Ingredient ID: NPC125732

Ingredient ID: NPC124830

Ingredient ID: NPC12319

Ingredient ID: NPC120926

Ingredient ID: NPC120867

Ingredient ID: NPC119271

Ingredient ID: NPC119107

Ingredient ID: NPC117038

Ingredient ID: NPC116775

Ingredient ID: NPC11433

Ingredient ID: NPC114239

Ingredient ID: NPC114011

Ingredient ID: NPC113098

Ingredient ID: NPC112890

Ingredient ID: NPC11201

Ingredient ID: NPC110639

Ingredient ID: NPC109813

Ingredient ID: NPC108888

Ingredient ID: NPC108494

Ingredient ID: NPC105246

Ingredient ID: NPC105095

Ingredient ID: NPC10286

Ingredient ID: NPC10285

Ingredient ID: NPC102091

Ingredient ID: NPC101294

Ingredient ID: NPC100809

Ingredient ID: NPC100570

Ingredient ID: NPC100502

Ingredient ID: NPC100445