• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Fragaria Chiloensis


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

NA

Click for details-----ITS2

GTCGTTGCCCCCCCGACCCCTTCGGGGGTCGGACGGGACGGATGATGGCCTTCCCGTGTGCCCCGTCACGCGGTTGGCATAAATACCGAGTCCTCGGCGACCGGCGCCGCGGCGATCGGTGGTTGTCAAACCTCGGTGCCTTGTCGCGTGCGTGAGTCGATCGCGGGACTTCCTTWGCCGTRAGCGCGTCGGTAACCCGACGCTTTCA
Taxonomic Information

Plant ID: NPO19760
Plant Latin Name: Fragaria Chiloensis
Taxonomy Genus: Fragaria
Taxonomy Family: Rosaceae

Plant External Links:

NCBI TaxonomyDB: 101007
Plant-of-the-World-Online: 724988-1

Used in Medicines

Unknown.

Geographical Distribution

Denmark; United States; Chile; Argentina; Bolivia; Norway

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

54 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


1 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

5 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC94796

Ingredient ID: NPC93075

Ingredient ID: NPC93020

Ingredient ID: NPC86668

Ingredient ID: NPC40089

Ingredient ID: NPC39379

Ingredient ID: NPC3245

Ingredient ID: NPC294457

Ingredient ID: NPC29172

Ingredient ID: NPC285154

Ingredient ID: NPC281428

Ingredient ID: NPC280547

Ingredient ID: NPC271086

Ingredient ID: NPC264425

Ingredient ID: NPC264317

Ingredient ID: NPC262649

Ingredient ID: NPC256546

Ingredient ID: NPC253773

Ingredient ID: NPC251641

Ingredient ID: NPC249014

Ingredient ID: NPC244702

Ingredient ID: NPC240340

Ingredient ID: NPC236607

Ingredient ID: NPC225629

Ingredient ID: NPC210537

Ingredient ID: NPC210234

Ingredient ID: NPC209611

Ingredient ID: NPC205513

Ingredient ID: NPC192403

Ingredient ID: NPC189689

Ingredient ID: NPC188727

Ingredient ID: NPC18825

Ingredient ID: NPC186941

Ingredient ID: NPC182107

Ingredient ID: NPC179174

Ingredient ID: NPC170838

Ingredient ID: NPC166924

Ingredient ID: NPC164858

Ingredient ID: NPC164158

Ingredient ID: NPC158329

Ingredient ID: NPC157297

Ingredient ID: NPC15439

Ingredient ID: NPC147116

Ingredient ID: NPC145040

Ingredient ID: NPC144462

Ingredient ID: NPC14148

Ingredient ID: NPC131190

Ingredient ID: NPC120559

Ingredient ID: NPC115062

Ingredient ID: NPC114031

Ingredient ID: NPC109868

Ingredient ID: NPC108724

Ingredient ID: NPC10321

Ingredient ID: NPC101428