• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Senecio Scandens


Example Image
PLANiTS DNA barcode

Click for details-----ITS

CCTGCGGAAGGATCATTGTCGAAACCTGCATAGCAGAACGACCCGTGAACATGTAACAATATATGGGTGTCCTTGGTATCACGCGCTTGTCTGATTCTTTGGATGCCACGTTGATGTGCATTTTTGGTAAATCATTTGGTTCCAAAGGATGTCACATTGACAAAACAACAACCCCCGGCACGGCATGTGCCAAGGAAAAGTAAACTAAAAAAGGGCTTGTGCCGTGATTCACCGTTCGCGGTGATTTCAAGGTATCTTGCTTCTTTATAATCACAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTTTGGCCAAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCACCTCCAAGCACACCTCTTGATGGGGATGTTGTAGTGGGGGCGGAGATTGGTCTCCCGTTCCTAAGGTGCGGTTGGCTAAAATAAGAGTCCCCTTCGTCGGATGCACGATTAGTGGTGGTTGTCAAGACCCTCTTGTCGAGTCGTGTGTTCAAAGGAGTAAGGAAGATCTCTTCGATGACCCTAAAGTGTCGTCTTGTACGATGCTCCGACAGCGACCCAGGTCAGGCGGGACTA

Click for details-----ITS1

CCTGCGGAAGGATCATTGTCGAAACCTGCATAGCAGAACGACCCGTGAACATGTAACAATATATGGGTGTCCTTGGTATCACGCGCTTGTCTGATTCTTTGGATGCCACGTTGATGTGCATTTTTGGTAAATCATTTGGTTCCAAAGGATGTCACATTGACAAAACAACAACCCCCGGCACGGCATGTGCCAAGGAAAAGTAAACTAAAAAAGGGCTTGTGCCGTGATTCACCGTTCGCGGTGATTTCAAGGTATCTTGCTTCTTTATAATCACAAA

Click for details-----ITS2

ATCGCGTCACCTCCAAGCACACCTCTTGATGGGGATGTTGTAGTGGGGGCGGAGATTGGTCTCCCGTTCCTAAGGTGCGGTTGGCTAAAATAAGAGTCCCCTTCGTCGGATGCACGATTAGTGGTGGTTGTCAAGACCCTCTTGTCGAGTCGTGTGTTCAAAGGAGTAAGGAAGATCTCTTCGATGACCCTAAAGTGTCGTCTTGTACGATGCTCCGACAGCGACCCAGGTCAGGCGGGACTA
Taxonomic Information

Plant ID: NPO19694
Plant Latin Name: Senecio Scandens
Taxonomy Genus: Senecio
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: 189247
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China; India

Traditional Medicine System:
Indian Folk; TCM


Medicinal Functions:

Depurative; Febrifuge; Ophthalmic

Geographical Distribution

India; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

150 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


113 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

72 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98620

Ingredient ID: NPC97663

Ingredient ID: NPC92562

Ingredient ID: NPC88789

Ingredient ID: NPC86227

Ingredient ID: NPC82374

Ingredient ID: NPC81010

Ingredient ID: NPC7569

Ingredient ID: NPC7349

Ingredient ID: NPC73418

Ingredient ID: NPC71703

Ingredient ID: NPC71074

Ingredient ID: NPC6984

Ingredient ID: NPC69445

Ingredient ID: NPC68903

Ingredient ID: NPC68160

Ingredient ID: NPC65133

Ingredient ID: NPC61779

Ingredient ID: NPC59581

Ingredient ID: NPC58284

Ingredient ID: NPC57249

Ingredient ID: NPC51700

Ingredient ID: NPC49457

Ingredient ID: NPC48623

Ingredient ID: NPC4605

Ingredient ID: NPC43728

Ingredient ID: NPC43300

Ingredient ID: NPC37110

Ingredient ID: NPC36061

Ingredient ID: NPC34550

Ingredient ID: NPC32977

Ingredient ID: NPC32021

Ingredient ID: NPC314267

Ingredient ID: NPC313528

Ingredient ID: NPC312800

Ingredient ID: NPC311987

Ingredient ID: NPC311621

Ingredient ID: NPC311295

Ingredient ID: NPC310604

Ingredient ID: NPC31032

Ingredient ID: NPC30911

Ingredient ID: NPC306386

Ingredient ID: NPC306207

Ingredient ID: NPC30395

Ingredient ID: NPC303511

Ingredient ID: NPC302857

Ingredient ID: NPC301702

Ingredient ID: NPC301585

Ingredient ID: NPC29883

Ingredient ID: NPC294902

Ingredient ID: NPC290613

Ingredient ID: NPC29

Ingredient ID: NPC289498

Ingredient ID: NPC289021

Ingredient ID: NPC284656

Ingredient ID: NPC282773

Ingredient ID: NPC281131

Ingredient ID: NPC281128

Ingredient ID: NPC280076

Ingredient ID: NPC279121

Ingredient ID: NPC279118

Ingredient ID: NPC27765

Ingredient ID: NPC275463

Ingredient ID: NPC274970

Ingredient ID: NPC272804

Ingredient ID: NPC27184

Ingredient ID: NPC269888

Ingredient ID: NPC26906

Ingredient ID: NPC264317

Ingredient ID: NPC261831

Ingredient ID: NPC260837

Ingredient ID: NPC260115

Ingredient ID: NPC255568

Ingredient ID: NPC25495

Ingredient ID: NPC254848

Ingredient ID: NPC250630

Ingredient ID: NPC243728

Ingredient ID: NPC243702

Ingredient ID: NPC23963

Ingredient ID: NPC239051

Ingredient ID: NPC238394

Ingredient ID: NPC235401

Ingredient ID: NPC230301

Ingredient ID: NPC229630

Ingredient ID: NPC228614

Ingredient ID: NPC224684

Ingredient ID: NPC220210

Ingredient ID: NPC219809

Ingredient ID: NPC219124

Ingredient ID: NPC218109

Ingredient ID: NPC217922

Ingredient ID: NPC217517

Ingredient ID: NPC216630

Ingredient ID: NPC216330

Ingredient ID: NPC212315

Ingredient ID: NPC209970

Ingredient ID: NPC209846

Ingredient ID: NPC207786

Ingredient ID: NPC203719

Ingredient ID: NPC201889

Ingredient ID: NPC196073

Ingredient ID: NPC195945

Ingredient ID: NPC195458

Ingredient ID: NPC195435

Ingredient ID: NPC193471

Ingredient ID: NPC192638

Ingredient ID: NPC188568

Ingredient ID: NPC18772

Ingredient ID: NPC183993

Ingredient ID: NPC179950

Ingredient ID: NPC179694

Ingredient ID: NPC1788

Ingredient ID: NPC17839

Ingredient ID: NPC178104

Ingredient ID: NPC176300

Ingredient ID: NPC173637

Ingredient ID: NPC172337

Ingredient ID: NPC171736

Ingredient ID: NPC168465

Ingredient ID: NPC167976

Ingredient ID: NPC165967

Ingredient ID: NPC165003

Ingredient ID: NPC162973

Ingredient ID: NPC162168

Ingredient ID: NPC16157

Ingredient ID: NPC160309

Ingredient ID: NPC16009

Ingredient ID: NPC15970

Ingredient ID: NPC158040

Ingredient ID: NPC156654

Ingredient ID: NPC155847

Ingredient ID: NPC150878

Ingredient ID: NPC143586

Ingredient ID: NPC13991

Ingredient ID: NPC138811

Ingredient ID: NPC132976

Ingredient ID: NPC127546

Ingredient ID: NPC121158

Ingredient ID: NPC12075

Ingredient ID: NPC118867

Ingredient ID: NPC117172

Ingredient ID: NPC115798

Ingredient ID: NPC114239

Ingredient ID: NPC111888

Ingredient ID: NPC110899

Ingredient ID: NPC1075

Ingredient ID: NPC107122

Ingredient ID: NPC106791

Ingredient ID: NPC103006

Ingredient ID: NPC100980