• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Solanum Chilense


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GTCGAAACTGGACCGCAGAACGACTCGCGAATCGTTTTAAACACTGGGGGCGGAGCTCGCTCGTCGCGCGCCTCCCTCCCGTCGCCCGCTGCTCGCAAGGTCTTCGGGGAACCAACGAACCCCGGCGCGGAAAGCGCCCAGGAATACTACAATCGAAAGCCCTCCCCCTCGCGCCCCGTTCGCGGATCGTGCGGAGGGGAAGCGCGCTGTTCTGTTAACACAAATAACTCTCGGCAACGGATATCTCCGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTTGGCGGAGGGCACGTCTGCGTGGGCGTCACGCATCGAGTCGCCCCCCCGCACGCCGCAAGGCTTAGCGCGGGGGCGGAAGATGGCCCCCCGTGCGCCCCGAGCGCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGGAACTCAACTCTCTCTTGTTGTCGCGGCTACAGCCCGTCGCGCGTCCGGACNCCCCGACCCTCACTGCGCCTTCAACGGGCGCTCCGACCGAGACGCCAGTCAAGGCGGG

Click for details-----ITS1

GTCGAAACTGGACCGCAGAACGACTCGCGAATCGTTTTAAACACTGGGGGCGGAGCTCGCTCGTCGCGCGCCTCCCTCCCGTCGCCCGCTGCTCGCAAGGTCTTCGGGGAACCAACGAACCCCGGCGCGGAAAGCGCCCAGGAATACTACAATCGAAAGCCCTCCCCCTCGCGCCCCGTTCGCGGATCGTGCGGAGGGGAAGCGCGCTGTTCTGTTAACACAAA

Click for details-----ITS2

ATCGAGTCGCCCCCCCGCACGCCGCAAGGCTTAGCGCGGGGGCGGAAGATGGCCCCCCGTGCGCCCCGAGCGCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGGAACTCAACTCTCTCTTGTTGTCGCGGCTACAGCCCGTCGCGCGTCCGGACNCCCCGACCCTCACTGCGCCTTCAACGGGCGCTCCGACCGAGACGCCAGTCAAGGCGGG
Taxonomic Information

Plant ID: NPO1967
Plant Latin Name: Solanum Chilense
Taxonomy Genus: Solanum
Taxonomy Family: Solanaceae

Plant External Links:

NCBI TaxonomyDB: 4083
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

13 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


11 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

11 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC61543

Ingredient ID: NPC52005

Ingredient ID: NPC51700

Ingredient ID: NPC295293

Ingredient ID: NPC272471

Ingredient ID: NPC264317

Ingredient ID: NPC225585

Ingredient ID: NPC203891

Ingredient ID: NPC181049

Ingredient ID: NPC178383

Ingredient ID: NPC142415

Ingredient ID: NPC129796

Ingredient ID: NPC120464