• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Albizia Amara


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

NA

Click for details-----ITS2

AACGTCGCCAGCGCCCGATCCCCCGGGCGCGGCGGATGATGGCCCCCCGGGAGCCCCGCCTCCCGGCCGGCCGAAAAAGGGGCCCTACGCGACGGCCGCCACGGTCCACGGTGGTTGAGCGAGCATTCGCTCGAGGCCAAGACGTGCGCGCGCCGTCCCGCGGCGAGGGCCCGACGGACGGGGCGGACCGCCCCACTCGC
Taxonomic Information

Plant ID: NPO19601
Plant Latin Name: Albizia Amara
Taxonomy Genus: Albizia
Taxonomy Family: Fabaceae

Plant External Links:

NCBI TaxonomyDB: 1179215
Plant-of-the-World-Online: 473171-1

Used in Medicines

Country/Region:
Kenya; Tanzania; Rwanda; India

Traditional Medicine System:

Geographical Distribution

Tanzania; India; Rwanda; Mozambique; Somalia; Sri Lanka; Kenya

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

12 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


8 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

9 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC9609

Ingredient ID: NPC93376

Ingredient ID: NPC78129

Ingredient ID: NPC45522

Ingredient ID: NPC42773

Ingredient ID: NPC256283

Ingredient ID: NPC25495

Ingredient ID: NPC244964

Ingredient ID: NPC202224

Ingredient ID: NPC176300

Ingredient ID: NPC160951

Ingredient ID: NPC145379