• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Bougainvillea Glabra


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

NA

Click for details-----ITS2

ATCGCGTTTCCCTCATCCACCCTTTATGGGTTGGAGGGGAAGGATGATGGCTTCCCGTGCACTTAATGCTCGCGGTTGGCTTAAAAAGGGAGCCCAATGCAACGAGTTGTTGCGCCAATTGGTGGTTGCCAAGCCCTTGCCGTAGTTACATCGTGCCGTGTGTGCATGTTGTCATTTGCAGCTCGCATGATCCAGATCAAACCG
Taxonomic Information

Plant ID: NPO19586
Plant Latin Name: Bougainvillea Glabra
Taxonomy Genus: Bougainvillea
Taxonomy Family: Nyctaginaceae

Plant External Links:

NCBI TaxonomyDB: 3541
Plant-of-the-World-Online: 35444-2

Used in Medicines

Country/Region:
Indonesia; China

Traditional Medicine System:
TCM

Geographical Distribution

Brazil; Jamaica; New Zealand; Bangladesh; Cuba; Indonesia; Bahamas; Trinidad and Tobago; China; Dominican Republic; Bolivia; Cameroon; Haiti

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

21 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


19 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

12 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC81010

Ingredient ID: NPC6984

Ingredient ID: NPC68533

Ingredient ID: NPC51146

Ingredient ID: NPC4796

Ingredient ID: NPC28862

Ingredient ID: NPC273309

Ingredient ID: NPC260557

Ingredient ID: NPC259221

Ingredient ID: NPC257188

Ingredient ID: NPC239029

Ingredient ID: NPC230301

Ingredient ID: NPC229375

Ingredient ID: NPC219913

Ingredient ID: NPC211131

Ingredient ID: NPC203719

Ingredient ID: NPC188278

Ingredient ID: NPC145879

Ingredient ID: NPC14359

Ingredient ID: NPC13007

Ingredient ID: NPC111888