CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Thespesia Populnea

Example Image

PLANiTS DNA barcode

Click for details-----ITS

GTAGGTGAACCTGCGGAAGGATCATTTCCGAAACCTGCCCAGCAGAACGACCCGCGAACGCGTTGTAAACAACACCGGAGGTGGTGGGGGTGCATCCTTGCCTCTCGCTACCCTCCACGTCTCGGAGCGATCGGTCTTGCAGTCCCTCCGCCCATCGGGCGGGGTGAGATGCCAGGTTCAACCTCTCCGAGGCAAAAACGTACAAACCCCCGGCGCGAATCGCGCCAAGGAATCGAAACGAAAAAAAGGGCACGTCTCATGTCGCCGCACCGTTCGCGGTGTCGGCGCTTCGGTGATGTTGTTCTTCCGTCGCGAAACACATACAGAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGCCCCCATCCAACCCCGAGCCCTCGGGCCTCGGTTGAACTGTGGGCGGAAATTGGCCTCCCGCGAGCTCACCGCCGGCGGTTGGCCTAAATACGAGCCCTCGACGACGGTATCGTCGCGACGATCGGTGGTAATGCTATCGGCTGCCTCGTTCGGAGTCGTGCACGTTCGTCGATCGAGGCCCCTGACCCCTTTTGGCATCGCAAGGACGGTGCTCGCA

Click for details-----ITS1

Click for details-----ITS2

ATCGTCGCCCCCATCCAACCCCGAGCCCTCGGGCCTCGGTTGAACTGTGGGCGGAAATTGGCCTCCCGCGAGCTCACCGCCGGCGGTTGGCCTAAATACGAGCCCTCGACGACGGTATCGTCGCGACGATCGGTGGTAATGCTATCGGCTGCCTCGTTCGGAGTCGTGCACGTTCGTCGATCGAGGCCCCTGACCCCTTTTGGCATCGCAAGGACGGTGCTCGCA

Taxonomic Information

Plant ID: NPO19367
Plant Latin Name: Thespesia Populnea
Taxonomy Genus: Thespesia
Taxonomy Family: Malvaceae

Plant External Links:

NCBI TaxonomyDB: 3638
Plant-of-the-World-Online: 564713-1

Used in Medicines

Country/Region:

Philippines; India

Traditional Medicine System:

Geographical Distribution

Bangladesh; Liberia; Sudan; Guinea; Cambodia; Bahamas; Netherlands; Somalia; Vanuatu; Nigeria; Cameroon; Burkina Faso; Benin; Ghana; Cuba; Venezuela; Cape Verde; Togo; China; Oman; Haiti; Belize; Tanzania; Eritrea; Maldives; Gambia; Philippines; New Caledonia; Mauritius; Trinidad and Tobago; Vietnam; Dominican Republic; Jamaica; Seychelles; Honduras; Mexico; India; Senegal; Mozambique; Colombia; Sri Lanka; Kenya; Taiwan; Fiji

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

20 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

14 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

11 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC99622

Ingredient ID: NPC95100

Ingredient ID: NPC68441

Ingredient ID: NPC58865

Ingredient ID: NPC475681

Ingredient ID: NPC474115

Ingredient ID: NPC474095

Ingredient ID: NPC474060

Ingredient ID: NPC40711

Ingredient ID: NPC2939

Ingredient ID: NPC279596

Ingredient ID: NPC231689

Ingredient ID: NPC211601

Ingredient ID: NPC198697

Ingredient ID: NPC19814

Ingredient ID: NPC147850

Ingredient ID: NPC141574

Ingredient ID: NPC13784

Ingredient ID: NPC135730

Ingredient ID: NPC133461

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Enzyme	ALOX12	Arachidonate 12-lipoxygenase	P18054	CHEMBL3687
Therapeutic Target	Enzyme	POLB	DNA polymerase beta	P06746	CHEMBL2392
Therapeutic Target	Miscellaneous ion channel	BCL2	Apoptosis regulator Bcl-2	P10415	CHEMBL4860
Therapeutic Target	Miscellaneous ion channel	BCL2L1	Apoptosis regulator Bcl-X	Q07817	CHEMBL4625
Therapeutic Target	Oxidoreductase	AKR1B1	Aldose reductase	P15121	CHEMBL1900

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	1

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT01977209	Gossypol Combined With Docetaxel and Cisplatin Scheme in Advanced Non Small-cell Lung Cancers With APE1 High Expression	non-small cell lung carcinoma	Gossypol (NPC68441)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	MCL1,BCL2L1,BCL2,POLB
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	BCL2,ALOX12,BCL2L1,AKR1B1
Malignant haematopoietic neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B33	BCL2,MCL1,BCL2L1
Myeloproliferative neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A20	BCL2,BCL2L1,MCL1
Lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	BCL2L1,MCL1,BCL2
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	BCL2L1,AKR1B1,POLB
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	ASPH,BCL2L1,POLB
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	ASPH,ALOX12,AKR1B1
Mature B-cell leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A82	BCL2L1,BCL2
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	BCL2,MCL1
Melanoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	MCL1,BCL2
Mature B-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A85	MCL1,BCL2
Multiple myeloma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A83	MCL1,BCL2
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	BCL2,AKR1B1
Melanoma of skin Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	ASPH,BCL2
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	BCL2L1,AKR1B1
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	BCL2
Pancreatic cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10	BCL2
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	BCL2
Chronic myelomonocytic leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A40	BCL2
Rheumatoid arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA20	AKR1B1
Follicular lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A80	BCL2
BCR-ABL1-negative chronic myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A41	BCL2
Malignant intestine neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C0Z	MCL1
Ovarian dysfunction Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A80	BCL2
Schizophrenia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20	AKR1B1
Diffuse large B-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	BCL2
Motor neuron disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B60	BCL2
Mastocytosis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A21	MCL1
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	AKR1B1
Neuropathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C0Z	AKR1B1
Prostate cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82	BCL2
Pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG3Z	AKR1B1
Ovarian cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73	BCL2
Glaucoma Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C61	AKR1B1
Cataract Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9B10	AKR1B1
Thrombosis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB61-GB90	AKR1B1
Stomach cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72	BCL2
Myelodysplastic syndrome Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A37	BCL2
Non-small cell lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	NCT01977209
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	ALOX12
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	BCL2
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	AKR1B1
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	AKR1B1
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	ALOX12
West Nile virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D46	MCL1
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	MCL1
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	AKR1B1
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	MCL1

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Thespesia Populnea

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

Country/Region:

Traditional Medicine System:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

20 All known Ingredients in Total

14 Ingredients with Acceptable Bioavailablity

11 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Solid tumour/cancer

Malignant neoplasms of biliary tract, distal bile duct

Malignant haematopoietic neoplasm

Myeloproliferative neoplasm

Lung cancer

Carcinosarcoma of uterus

Adenocarcinoma of pancreas

Germ cell tumour of testis

Mature B-cell leukaemia

Acute myeloid leukaemia

Melanoma

Mature B-cell lymphoma

Multiple myeloma

Diffuse large B-cell lymphomas

Melanoma of skin

Malignant neoplasms of thymus

Breast cancer

Pancreatic cancer

Psoriasis

Chronic myelomonocytic leukaemia

Rheumatoid arthritis

Follicular lymphoma

BCR-ABL1-negative chronic myeloid leukaemia

Malignant intestine neoplasm

Ovarian dysfunction

Schizophrenia

Diffuse large B-cell lymphoma

Motor neuron disease

Mastocytosis

Acute diabete complication

Neuropathy

Prostate cancer

Pain, unspecified

Ovarian cancer

Glaucoma

Cataract

Thrombosis

Stomach cancer

Myelodysplastic syndrome

Non-small cell lung cancer

Serous cystadenoma,borderline malignancy of ovary

Pheochromocytoma

Hepatoblastoma

Leishmaniasis

Squamous cell carcinoma of bronchus or lung

West Nile virus infection

Superficial ovarian endometriosis

Urothelial carcinoma of bladder

Glioblastoma of brain

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

>> Targets derived from weak experimental activities