CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Macleaya Cordata

Example Image

PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCCTAGCAGAACGACCCGCGAACGCGTGAATCCAAGTTCCAGAGGCGCGGCGATCAGGAGCGATCCCCCTCACCGGGCCCCCGGCCGTCCGGAGAGGCCCCGGCCCTTCCGGACGGACAACGAACCCTACGGCGTGGACCATGACAAGGAACCAACAAACGGAGAAAGCGCACCGCCCCCCGTCCTCCAAGGCATAGTGGGCAGCGTAGCGAGATCCGATCTTTGAACGACTCTCGGCAACGGATATCTCAGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGCGAATTGCAGAATCCCATGAACCATCGAGTTTTTGAACGCAATTGCGCCCTAGGCCACCAGGCCAAGGGCACACCTGCCTGGGCATCACGTACCGAGTCGCCCCATCCCCCCGCAGGCGGGAGGGGGCAGACACTGGCCCCCAATGCCTCCATGTGCGGCCGGCCCAAACTCGGTCCTTGGGCGGCCGGCGTCACGATCCATGGTGGTYGACACGAGAGTTGTCTAAAGCCAGAATCCGTGGCCGCTGACGCCTCCCCACACGGGCCACAGGGACCCCTCTGGGCCGCACCAGCCGCGGTGCCCACTCT

Click for details-----ITS1

Click for details-----ITS2

TACCGAGTCGCCCCCTCCCCCCGCAKGCGGGAGGGGGCGGACACTGGCCCCCAATGCCTTCCATGTGCGGCCGGCCCAAACTCGGTCCTTGGGCGGCCGACGTCACGATCCATGGTGGTCGACCCGAGAGTTGTCTAAAGCCAGAATCCGTGGCCGCTGCGCCTCCCCACCGGGCCACAGGGACCCCTCTGGACCGCACCAGCCGCGGTGCCCATTCT

Taxonomic Information

Plant ID: NPO19264
Plant Latin Name: Macleaya Cordata
Taxonomy Genus: Macleaya
Taxonomy Family: Papaveraceae

Plant External Links:

NCBI TaxonomyDB: 56857
Plant-of-the-World-Online: 673258-1

Used in Medicines

Country/Region:

China

Traditional Medicine System:

TCM

Medicinal Functions:

Carminative; Depurative; Diuretic; Stings

Geographical Distribution

Ukraine; United States; China; South Africa

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

31 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

29 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

19 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC97405

Ingredient ID: NPC74765

Ingredient ID: NPC71506

Ingredient ID: NPC68889

Ingredient ID: NPC67978

Ingredient ID: NPC37947

Ingredient ID: NPC314828

Ingredient ID: NPC312132

Ingredient ID: NPC307065

Ingredient ID: NPC302001

Ingredient ID: NPC297643

Ingredient ID: NPC27184

Ingredient ID: NPC259512

Ingredient ID: NPC255042

Ingredient ID: NPC247266

Ingredient ID: NPC24327

Ingredient ID: NPC23614

Ingredient ID: NPC233121

Ingredient ID: NPC211631

Ingredient ID: NPC211105

Ingredient ID: NPC210003

Ingredient ID: NPC186798

Ingredient ID: NPC182840

Ingredient ID: NPC166894

Ingredient ID: NPC157414

Ingredient ID: NPC150329

Ingredient ID: NPC144719

Ingredient ID: NPC131981

Ingredient ID: NPC109813

Ingredient ID: NPC105246

Ingredient ID: NPC100079

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Cytochrome P450	Cytochrome P450 family 2	CYP2D6	Cytochrome P450 2D6	P10635	CHEMBL289
Therapeutic Target	Nuclear hormone receptor subfamily 1	PPARG	Peroxisome proliferator-activated receptor gamma	P37231	CHEMBL235
Therapeutic Target	Oxidoreductase	MAOA	Monoamine oxidase A	P21397	CHEMBL1951
Therapeutic Target	Small molecule receptor (family A GPCR)	CNR2	Cannabinoid CB2 receptor	P34972	CHEMBL253
Therapeutic Target	Structural protein	LMNA	Prelamin-A/C	P02545	CHEMBL1293235

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	3

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT01637948	Controlled Clinical Trial of Traditional Chinese Medicine Mouthrinse	gingivitis	Thymol (NPC259512)	NP level
NCT01119534	Comparative Efficacy of the Suppository Versus Guaiacol Suppository Versus Guaifenesin Syrup in Pediatric Patients With Cough Due the Infectious Origin	Cough	Camphor (NPC131981)	NP level
NCT00885599	Efficacy of a Naturally-derived Mouthrinse for Gingival Inflammation	gingivitis	Thymol (NPC259512)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	PPARG,CNR2,LMNA
General pain disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8E43	MAOA,CNR2
Inborn lipid metabolism error Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C52	CNR2,PPARG
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	PPARG,MAOA
Insomnia Disease Category: 07.Sleep-wake disorders Disease ICD-11 Code: 7A00-7A0Z	CYP2D6,CNR2
Gingival diseases Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA0B	NCT01637948,NCT00885599
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	CNR2,LMNA
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	CNR2,LMNA
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	PPARG,LMNA
Hyper-lipoproteinaemia Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C80	PPARG
Depression Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A70-6A7Z	MAOA
Nicotine use disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C4A	PPARG
Gout Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA25	PPARG
Opioid use disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C43	PPARG
Diabetes mellitus, type unspecified Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A14	PPARG
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	MAOA
Skin tag/polyp Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EK71	MAOA
Mood disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A60-6E23	MAOA
Non-alcoholic fatty liver disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB92	PPARG
Glaucoma Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C61	PPARG
Pulmonary hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BB01	PPARG
Acquired hypomelanotic disorder Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED63	MAOA
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	PPARG
Atopic eczema Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA80	CNR2
Multiple sclerosis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A40	PPARG
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	PPARG
Substance abuse Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C40	MAOA
Sjogren syndrome Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A43	PPARG
Obesity Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B80-5B81	PPARG
Crohn disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD70	CNR2
Malaria Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F40-1F45	CYP2D6
Prostate cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82	MAOA
Attention deficit hyperactivity disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A05	CNR2
Pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG3Z	CNR2
Indeterminate colitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD72	PPARG
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	PPARG
Cough Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MD12	NCT01119534
Dengue fever, unspecified Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D2Z	MAOA
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	LMNA
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	CNR2
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	LMNA
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	CNR2
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	CYP2D6
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	CYP2D6
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	CNR2
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	CNR2
Human immunodeficiency virus disease without mention of tuberculosis or malaria Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C62	CNR2
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	LMNA
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	CNR2

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Macleaya Cordata

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

Country/Region:

Traditional Medicine System:

Medicinal Functions:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

31 All known Ingredients in Total

29 Ingredients with Acceptable Bioavailablity

19 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Adenocarcinoma of pancreas

General pain disorder

Inborn lipid metabolism error

Alzheimer disease

Insomnia

Gingival diseases

Diffuse large B-cell lymphomas

Mesothelioma of pleura

Chikungunya virus disease

Hyper-lipoproteinaemia

Depression

Nicotine use disorder

Gout

Opioid use disorder

Diabetes mellitus, type unspecified

Parkinsonism

Skin tag/polyp

Mood disorder

Non-alcoholic fatty liver disease

Glaucoma

Pulmonary hypertension

Acquired hypomelanotic disorder

Solid tumour/cancer

Atopic eczema

Multiple sclerosis

Type 2 diabetes mellitus

Substance abuse

Sjogren syndrome

Obesity

Crohn disease

Malaria

Prostate cancer

Attention deficit hyperactivity disorder

Pain, unspecified

Indeterminate colitis

Acute diabete complication

Cough

Dengue fever, unspecified

Malignant neoplasms of biliary tract, distal bile duct

Leishmaniasis

Superficial ovarian endometriosis

Cytomegaloviral disease

Adenocarcinoma of bronchus or lung

Malignant neoplasms of corpus uteri, unspecified

Malignant neoplasms of thymus

Invasive carcinoma of breast

Human immunodeficiency virus disease without mention of tuberculosis or malaria

Glioblastoma of brain

Germ cell tumour of testis

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

>> Targets derived from weak experimental activities