CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Sophora Flavescens

Example Image

PLANiTS DNA barcode

Click for details-----ITS

TCGAATCCTCACGAAGCAGTGCGACCCGTGAATTTGTTTGACTCCTTGGGTGCGGCTTGAGGTGCATGGCGCCTCGGTCCCCCTAGTGTTGGGAGGTGCCCTCCTCGTGCGGGCCCATCCTGGCCCATTAACAAAACCCCGGCGCCGAATGCGCCAAGGAAATCGAGATTGTCTAGCGCGTCCCCCTCGGCACCGGAGACGGTGCCCGTGTGGTGGCGTTGCGACAAGTGTATCCAAAAGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCAATGCCTCAGCCCTGTTGCTAGGCATAGTAAAGGGGTGAATGTTGGCTTCCCGTGAGCGATGCCTCGCGGTTGGCTGAAAATTGAGTCCGTGGTGGAGTGCGCCGCGATGGATGGTGGTTGAGTAAGAGCTCGAGACCGATCGTGTGTGTCACCCCTACCGGATTTGGGACTCTTTGACCCATGAGCGGCCGTTGGCTGCCCACGACGGACCTCAGTCAGCGGGCTACCCGCTGAGTTA

Click for details-----ITS1

AGGTGAACCTGCGGAAGGATCATTGTCGAATCCTCACGAAGCAGTGCGACCCGTGAATTTGTTTGACTCCTTGGGTGCGGCTTGAGGTGCATGGTGCCTCGGTCCCCCAAGTGTTGGGAGGTGCCCTCCTCGTGCGGGCCCATCCTGGCCCATTAACAAAACCCCGGCGCCGAATGCGCCAAGGAAATCGAGATTGTCTAGTGCGTCCCCCTCGGCACCGGAGACGGTGCCCGTGTGGTGGCGTTGCGACAAGTGTATCCAAA

Click for details-----ITS2

ATCGTTGCCCCAATGCCTCAGCCCTGTTGCTAGGCATAGTAAAGGGGTGAATGTTGGCTTCCCGTGAGCGATGCCTCGCGGTTGGCTGAAAATTGAGTCCGTGGTGGAGTGCGCCGCGATGGATGGTGGTTGAGTAAGAGCTCGAGACCGATCGTGTGTGTCACCCCTACCGGATTTGGGACTCTTTGACCCATGAGCGGCCGTTGGCTGCCCACGACGGACCTCAGTCAGCGGGCTACCCGCTGAGTTA

Taxonomic Information

Plant ID: NPO19231
Plant Latin Name: Sophora Flavescens
Taxonomy Genus: Sophora
Taxonomy Family: Fabaceae

Plant External Links:

NCBI TaxonomyDB: 49840
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:

South Korea; China

Traditional Medicine System:

TCM; Kampo

Medicinal Functions:

Anthelmintic; Antibacterial; Antifungal; Antipruritic; Astringent; Bitter; Carminative; Diuretic; Febrifuge; Parasiticide; Parasiticide; Pectoral; Stomachic; Tonic

Geographical Distribution

South Korea; China

Geographical Distribution

−

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Cytochrome P450	Cytochrome P450 family 1	CYP1B1	Cytochrome P450 1B1	Q16678	CHEMBL4878
Cytochrome P450	Cytochrome P450 family 1	CYP1A1	Cytochrome P450 1A1	P04798	CHEMBL2231
Cytochrome P450	Cytochrome P450 family 1	CYP1A2	Cytochrome P450 1A2	P05177	CHEMBL3356
Cytochrome P450	Cytochrome P450 family 2	CYP2C9	Cytochrome P450 2C9	P11712	CHEMBL3397
Therapeutic Target	Enzyme	MIF	Macrophage migration inhibitory factor	P14174	CHEMBL2085
Therapeutic Target	Enzyme	POLB	DNA polymerase beta	P06746	CHEMBL2392
Therapeutic Target	Enzyme	BLM	Bloom syndrome protein	P54132	CHEMBL1293237
Therapeutic Target	Enzyme	NOX4	NADPH oxidase 4	Q9NPH5	CHEMBL1250375
Therapeutic Target	Enzyme	CES1	Acyl coenzyme A:cholesterol acyltransferase	P23141	CHEMBL2265
Therapeutic Target	Enzyme	ALOX12	Arachidonate 12-lipoxygenase	P18054	CHEMBL3687

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT00000559	Women's Estrogen/Progestin Lipid Lowering Hormone Atherosclerosis Regression Trial (WELL-HART)	menopause;Myocardial Ischemia	Estradiol (NPC48342)	NP level
NCT00000831	Virologic Responses To New Nucleoside Regimens After Prolonged ZDV or ddI Monotherapy	HIV infection	Lamivudine (NPC469972)	NP level
NCT00000834	A Phase I Study of Methotrexate for HIV Infection	HIV infection	Lamivudine (NPC469972)	NP level
NCT00000838	Antiviral Activity of and Resistance to Lamivudine in Combination With Zidovudine, Stavudine, or Didanosine	HIV infection	Lamivudine (NPC469972)	NP level
NCT00000841	A Study of Indinavir Sulfate Plus Zidovudine (AZT) Plus Lamivudine in HIV-Infected Patients Who Have Taken AZT for Six or More Months	HIV infection	Lamivudine (NPC469972)	NP level
NCT00000865	The Safety and Effects of 1592U89 Used Alone or in Combination With Other Anti-HIV Drugs in HIV-Infected Infants and Children	HIV infection	Lamivudine (NPC469972)	NP level
NCT00000870	A Phase II Study of Intermittent Recombinant Human Interleukin-2 (rhIL-2) by Intravenous or Subcutaneous Administration in Subjects With HIV Infection on Highly Active Antiretroviral Therapy (HAART) Compared to HAART Alone	HIV infection	Lamivudine (NPC469972)	NP level
NCT00000872	Treatment With Combinations of Several Antiviral Drugs in Infants and Young Children With HIV Infection	HIV infection	Lamivudine (NPC469972)	NP level
NCT00000882	Virologic and Immunologic Activity of Continued Lamivudine (3TC) vs Delavirdine (DLV) in Combination With Indinavir (IDV) and Zidovudine (ZDV) or Stavudine (d4T) in 3TC-Experienced Subjects	HIV infection	Lamivudine (NPC469972)	NP level
NCT00000885	Treatment Success and Failure in HIV-Infected Subjects Receiving Indinavir in Combination With Nucleoside Analogs: A Rollover Study for ACTG 320	HIV infection	Lamivudine (NPC469972)	NP level

Associated Disease of the Plant	Association Type & Detailed Evidence
Acidosis Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C73	CACNA1H
Acne vulgaris Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED80	ESR1,AR
Acquired hypermelanosis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED60	TYR
Acquired hypomelanotic disorder Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED63	MAOA,MAOB,TYR
Acquired prion disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8E01	ESR1
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	KDR,AURKB,DPP4,AKR1B1
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	AXL,SRC,AR,TP53,MAPT,IDO1,FLT3,GSK3B,PIM1,AURKB
Acute respiratory distress syndrome Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB00	NCT03718507
Acute viral hepatitis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1E50	NCT00076336
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	ACHE,AKR1C3,BLM,MMP12,CA7,F2,CA9,XDH,TTR,THPO,CYP2C9,CDK1,CA12,TSHR,AURKB,NPSR1

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Sophora Flavescens

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

Country/Region:

Traditional Medicine System:

Medicinal Functions:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

428 All known Ingredients in Total

298 Ingredients with Acceptable Bioavailablity

182 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Acidosis

Acne vulgaris

Acquired hypermelanosis

Acquired hypomelanotic disorder

Acquired prion disease

Acute diabete complication

Acute myeloid leukaemia

Acute respiratory distress syndrome

Acute viral hepatitis

Adenocarcinoma of bronchus or lung

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

>> Targets derived from weak experimental activities