CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Erica Arborea

Example Image

PLANiTS DNA barcode

Click for details-----ITS

TCAAAACCTGACATCTAGAAAACTCGTGAACTTGTTCATAAAGAATGGGGAATGCATCGGTTTGGCCCAGTGCCTCTCCTTTTGCTTTCCCCTCGCAAGCAGACATGCCTGGAGCTTTCGAGCGACGTGTTTGTCTGCTTGTCGAACAAYGAACCCCGGCGCAAATCGTGCCAAGGATAATGGAATGAGTTTGTGCATGCATGTCCCTGCCCGTCTATGGGTGGCGTTGGCTTGCACATCTTTTGTATAACTAAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAAGCCATCAGGTTGAAGGCACGTCTGCCTGGGCGTCACGCATTGCGTCGCTCACTCACCCCGTGCCTCACAGGGCGGGTAAGTGCGTGGGCGGATATTGGCCCCCCGTTCACATTTGTGCTCGGTTGGCCTAAAAAGAAGGTCCCTGATGACGGACATCACAACAAGTGGTGGTTGCCAAACTGTCGCGACACGTTGTGCATGCTACGCAGTCGTCGGTGGGCTCATTGACCCTTAAGTGCCATTGAACTTGGTACCTCAACTGCGACCCCAGGT

Click for details-----ITS1

TCAAAACCTGACATCTAGAAAACTCGTGAACTTGTTCATAAAGAATGGGGAATGCATCGGTTTGGCCCAGTGCCTCTCCTTTTGCTTTCCCCTCGCGAGCAGACATGCCTGGAGCTTTCGAGCGACGTGTTTGTCTGCTTGTCGAACAACGAACCCCGGCGCAAATCGTGCCAAGGATAATGGAATGAGTTTGTGCATGCATGTCCCTGCCCGTCTATGGGTGGCGTTGGCTTGCACATCTTTTGTATAACTAAA

Click for details-----ITS2

ATTGCGTCGCTCACTCACCCCGTGCCTCACAGGGCGGGTAAGTGCGTGGGCGGATATTGGCCCCCCGTTCACATTTGTGCTCGGTTGGCCTAAAAAGAAGGTCCCTGATGACGGACATCACAACAAGTGGTGGTTGCCAAACTGTCGCGACACGTTGTGCATGCTACGCAGTCGTCGGTGGGCTCATTGACCCTTAAGTGCCATTGAACTTGGTACCTCAACTGCGACCCCAGGT

Taxonomic Information

Plant ID: NPO1919
Plant Latin Name: Erica Arborea
Taxonomy Genus: Erica
Taxonomy Family: Ericaceae

Plant External Links:

NCBI TaxonomyDB: 270431
Plant-of-the-World-Online: 328204-1

Used in Medicines

Country/Region:

Turkey; China; Italy

Traditional Medicine System:

TCM

Geographical Distribution

Turkey; Italy; Sudan; France; Ethiopia; Rwanda; Somalia; Saudi Arabia; Algeria; China; Spain; Eritrea; Tanzania; Morocco; New Zealand; Yemen; Russia; Bulgaria; Albania; Portugal; Chad; Tunisia; United Kingdom; Uganda; Greece; Kenya

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

29 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

21 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

9 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC97320

Ingredient ID: NPC96820

Ingredient ID: NPC88295

Ingredient ID: NPC66826

Ingredient ID: NPC66311

Ingredient ID: NPC50542

Ingredient ID: NPC35128

Ingredient ID: NPC311907

Ingredient ID: NPC30563

Ingredient ID: NPC304127

Ingredient ID: NPC295295

Ingredient ID: NPC293368

Ingredient ID: NPC280254

Ingredient ID: NPC276111

Ingredient ID: NPC229613

Ingredient ID: NPC21458

Ingredient ID: NPC202507

Ingredient ID: NPC18603

Ingredient ID: NPC184810

Ingredient ID: NPC1786

Ingredient ID: NPC173637

Ingredient ID: NPC17215

Ingredient ID: NPC16878

Ingredient ID: NPC153234

Ingredient ID: NPC144846

Ingredient ID: NPC144441

Ingredient ID: NPC127585

Ingredient ID: NPC126029

Ingredient ID: NPC104738

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Enzyme	ALPL	Alkaline phosphatase, tissue-nonspecific isozyme	P05186	CHEMBL5979
Therapeutic Target	Lyase	CA6	Carbonic anhydrase VI	P23280	CHEMBL3025
Therapeutic Target	Lyase	CA2	Carbonic anhydrase II	P00918	CHEMBL205
Therapeutic Target	Oxidoreductase	HSD17B10	Endoplasmic reticulum-associated amyloid beta-peptide-binding protein	Q99714	CHEMBL4159
Therapeutic Target	Phosphodiesterase	TDP1	Tyrosyl-DNA phosphodiesterase 1	Q9NUW8	CHEMBL1075138
Therapeutic Target	Protein Kinase	FYN	Tyrosine-protein kinase FYN	P06241	CHEMBL1841
Therapeutic Target	Transcription factor	NFKB1	Nuclear factor NF-kappa-B p105 subunit	P19838	CHEMBL3251

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	3

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT01880866	(-)-Epicatechin and Pulmonary Arterial Hypertension	pulmonary arterial hypertension	(-)-Epicatechin (NPC126029)	NP level
NCT03236662	(-)- Epicatechin Becker Muscular Dystrophy	Becker muscular dystrophy	(-)-Epicatechin (NPC126029)	NP level
NCT01856868	Use of (-)-Epicatechin in the Treatment of Becker Muscular Dystrophy (Pilot Study)	Becker muscular dystrophy	(-)-Epicatechin (NPC126029)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	TDP1,ALPL,HSD17B10,AKR1B1,CA2
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	CA6,FYN,NFKB1,CA2
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	CA6,AKR1B1,NFKB1,HSD17B10
Rheumatoid arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA20	AKR1B1,NFKB1,CA2
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	ALPL,CA2,TDP1
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	TDP1,HSD17B10,AKR1B1
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	SNCA,FYN,CA2
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	CA6,ALPL,CA2
Bacterial infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-1C4Z	CA6,CA2
Seborrhoeic dermatitis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA81	CA6,CA2
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	CA6,CA2
Glaucoma Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C61	AKR1B1,CA2
Becker muscular dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C70.0	NCT03236662,NCT01856868
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	SNCA,CA2
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	AKR1B1,ALPL
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	SNCA,TDP1
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	SNCA,CA2
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	AKR1B1,CA2
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	SNCA,AKR1B1
Myeloproliferative neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A20	FYN
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	SNCA
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	SNCA
Low bone mass disorder Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FB83	CA2
Fungal infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F29-1F2F	NFKB1
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	NFKB1
Autonomic nervous system disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8D87	SNCA
Indeterminate colitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD72	NFKB1
Lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40	NFKB1
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	NFKB1
Atopic eczema Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA80	NFKB1
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	NFKB1
Cataract Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9B10	AKR1B1
Choreiform disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A01	NFKB1
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	AKR1B1
Colon cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90	ALPL
Muscular dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C70	NFKB1
Thrombosis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB61-GB90	AKR1B1
Duodenal ulcer Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA63	CA2
Multiple myeloma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A83	FYN
Diabetes mellitus, type unspecified Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A14	NFKB1
Multiple sclerosis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A40	NFKB1
Skin and skin-structure infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F28-1G0Z	NFKB1
Irritable bowel syndrome Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD91	NFKB1
Genetic prion disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8E02	ALPL
Heart failure Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD10-BD1Z	CA2
Essential hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00	CA2
Schizophrenia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20	AKR1B1
Pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG3Z	AKR1B1
Insomnia Disease Category: 07.Sleep-wake disorders Disease ICD-11 Code: 7A00-7A0Z	CA2
Parasitic infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D0Y-1G2Z	ALPL
Neuropathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C0Z	AKR1B1
Acute/subacute hepatic failure Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB91	NFKB1
Pulmonary hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BB01	NCT01880866
Crohn disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD70	ALPL
Inflammatory bowel diseases, unspecified Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD7Z	ALPL
Osteoarthritis, unspecified Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA0Z	ALPL
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	AKR1B1
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	AKR1B1
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	CA6
Keratoconus Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9A78.50	CA6
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	CA6
West Nile virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D46	NFKB1
Other specified malignant neoplasms ofcolon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90.Y	CA6
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	CA2
Malignant neoplasms of thyroid gland, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10.Z	ALPL
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	CA6
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	CA2
Renal cell carcinoma, chromophobe type Disease Category: X.Extension Codes Disease ICD-11 Code: XH6153	CA2
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	FYN
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	SNCA

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Erica Arborea

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

Country/Region:

Traditional Medicine System:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

29 All known Ingredients in Total

21 Ingredients with Acceptable Bioavailablity

9 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Carcinosarcoma of uterus

Solid tumour/cancer

Malignant neoplasms of thymus

Rheumatoid arthritis

Serous cystadenoma,borderline malignancy of ovary

Diffuse large B-cell lymphomas

Adenocarcinoma of pancreas

Malignant neoplasms of corpus uteri, unspecified

Bacterial infection

Seborrhoeic dermatitis

Breast cancer

Glaucoma

Becker muscular dystrophy

Pheochromocytoma

Leishmaniasis

Mesothelioma of pleura

Superficial ovarian endometriosis

Urothelial carcinoma of bladder

Germ cell tumour of testis

Myeloproliferative neoplasm

Alzheimer disease

Parkinsonism

Low bone mass disorder

Fungal infection

Type 2 diabetes mellitus

Autonomic nervous system disorder

Indeterminate colitis

Lupus erythematosus

Psoriasis

Atopic eczema

Acute myeloid leukaemia

Cataract

Choreiform disorder

Acute diabete complication

Colon cancer

Muscular dystrophy

Thrombosis

Duodenal ulcer

Multiple myeloma

Diabetes mellitus, type unspecified

Multiple sclerosis

Skin and skin-structure infection

Irritable bowel syndrome

Genetic prion disease

Heart failure

Essential hypertension

Schizophrenia

Pain, unspecified

Insomnia

Parasitic infection

Neuropathy

Acute/subacute hepatic failure

Pulmonary hypertension

Crohn disease

Inflammatory bowel diseases, unspecified

Osteoarthritis, unspecified

Malignant neoplasms of biliary tract, distal bile duct

Hepatoblastoma

Adenocarcinoma of stomach

Keratoconus

Squamous cell carcinoma of bronchus or lung

West Nile virus infection