CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Brickellia Pendula

Example Image

PLANiTS DNA barcode

ATCACGTTGCCCACATTAAACATCCTATGCTGGAATTTGATTAATGTGGGCGGAGACTGGTCTCCCGTGCTCATATTGCGGTTGACCCAAATACGAGCCCCCCAAAGGGTGATATGCASGATTGGTGGTGGTTGGCTACACAGTCGTCTCGTGTCGTGTGTATCGATCCTTGGAAGGGAAAACTCCTAAAAAAAACCCTGATGTGTTGTGTTGCTGCAACTCTACGATC

Taxonomic Information

Plant ID: NPO19189
Plant Latin Name: Brickellia Pendula
Taxonomy Genus: Brickellia
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: 1550857
Plant-of-the-World-Online: n.a.

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

104 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

88 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

25 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC91858

Ingredient ID: NPC87457

Ingredient ID: NPC86126

Ingredient ID: NPC80230

Ingredient ID: NPC79273

Ingredient ID: NPC74101

Ingredient ID: NPC7302

Ingredient ID: NPC71665

Ingredient ID: NPC66501

Ingredient ID: NPC58212

Ingredient ID: NPC56184

Ingredient ID: NPC55138

Ingredient ID: NPC51945

Ingredient ID: NPC50230

Ingredient ID: NPC45956

Ingredient ID: NPC39068

Ingredient ID: NPC3753

Ingredient ID: NPC34497

Ingredient ID: NPC33611

Ingredient ID: NPC32938

Ingredient ID: NPC32373

Ingredient ID: NPC32222

Ingredient ID: NPC3182

Ingredient ID: NPC310837

Ingredient ID: NPC310512

Ingredient ID: NPC309399

Ingredient ID: NPC299676

Ingredient ID: NPC297280

Ingredient ID: NPC294575

Ingredient ID: NPC292559

Ingredient ID: NPC285390

Ingredient ID: NPC283039

Ingredient ID: NPC279666

Ingredient ID: NPC277279

Ingredient ID: NPC274022

Ingredient ID: NPC269802

Ingredient ID: NPC268466

Ingredient ID: NPC264107

Ingredient ID: NPC263043

Ingredient ID: NPC261652

Ingredient ID: NPC260484

Ingredient ID: NPC260473

Ingredient ID: NPC254808

Ingredient ID: NPC252655

Ingredient ID: NPC247047

Ingredient ID: NPC245948

Ingredient ID: NPC24567

Ingredient ID: NPC241643

Ingredient ID: NPC240308

Ingredient ID: NPC239936

Ingredient ID: NPC237946

Ingredient ID: NPC230968

Ingredient ID: NPC227894

Ingredient ID: NPC227331

Ingredient ID: NPC226008

Ingredient ID: NPC225284

Ingredient ID: NPC224291

Ingredient ID: NPC223064

Ingredient ID: NPC219106

Ingredient ID: NPC218973

Ingredient ID: NPC218525

Ingredient ID: NPC216460

Ingredient ID: NPC215894

Ingredient ID: NPC21430

Ingredient ID: NPC213336

Ingredient ID: NPC210354

Ingredient ID: NPC199786

Ingredient ID: NPC19890

Ingredient ID: NPC197011

Ingredient ID: NPC195777

Ingredient ID: NPC193770

Ingredient ID: NPC19202

Ingredient ID: NPC191436

Ingredient ID: NPC188650

Ingredient ID: NPC184639

Ingredient ID: NPC183193

Ingredient ID: NPC181474

Ingredient ID: NPC180903

Ingredient ID: NPC179546

Ingredient ID: NPC172968

Ingredient ID: NPC172298

Ingredient ID: NPC171512

Ingredient ID: NPC169418

Ingredient ID: NPC166303

Ingredient ID: NPC165780

Ingredient ID: NPC165462

Ingredient ID: NPC165241

Ingredient ID: NPC161923

Ingredient ID: NPC160295

Ingredient ID: NPC156249

Ingredient ID: NPC155922

Ingredient ID: NPC149505

Ingredient ID: NPC146081

Ingredient ID: NPC142545

Ingredient ID: NPC137320

Ingredient ID: NPC133666

Ingredient ID: NPC132263

Ingredient ID: NPC125226

Ingredient ID: NPC119753

Ingredient ID: NPC119277

Ingredient ID: NPC117581

Ingredient ID: NPC115388

Ingredient ID: NPC101755

Ingredient ID: NPC100570

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Cytochrome P450	Cytochrome P450 family 3	CYP3A4	Cytochrome P450 3A4	P08684	CHEMBL340
Therapeutic Target	Hydrolase	RAB9A	Ras-related protein Rab-9A	P51151	CHEMBL1293294
Therapeutic Target	Methyl-lysine/arginine binding protein	SMN1	Survival motor neuron protein	Q16637	CHEMBL1293232
Therapeutic Target	Nuclear hormone receptor subfamily 3	NR3C1	Glucocorticoid receptor	P04150	CHEMBL2034
Therapeutic Target	Structural protein	LMNA	Prelamin-A/C	P02545	CHEMBL1293235
Therapeutic Target	Transcription factor	HIF1A	Hypoxia-inducible factor 1 alpha	Q16665	CHEMBL4261
Therapeutic Target	Transcription factor	PAX8	Paired box protein Pax-8	Q06710	CHEMBL2362980
Therapeutic Target	Transporter	NPC1	Niemann-Pick C1 protein	O15118	CHEMBL1293277

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	6

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT03532776	Comparison Between Podofilox Topical Gel 0.5% and Allergan's Condylox® Gel 0.5% for External Anogenital Warts	anogenital venereal wart	Podofilox (NPC237946)	NP level
NCT01721577	Phase I/II Trial of AXL1717 in the Treatment of Recurrent Malignant Astrocytomas	anaplastic astrocytoma;anaplastic oligodendroglioma;gliosarcoma	Picropodophyllotoxin (NPC32373)	NP level
NCT01561456	Study of AXL1717 Compared to Docetaxel to Treat Squamous Cell Carcinoma or Adenocarcinoma of the Lung	lung adenocarcinoma;squamous cell carcinoma	Picropodophyllotoxin (NPC32373)	NP level
NCT01466647	A Study of the IGF-1R Inhibitor AXL1717 in Combination With Gemcitabine HCL and Carboplatin to Treat Non-small-cell Lung Cancer (NSCLC)	non-small cell lung carcinoma	Picropodophyllotoxin (NPC32373)	NP level
NCT01062620	A Dose Escalating Clinical Trial of the IGF-1 Receptor Inhibitor AXL1717 in Patients With Advanced Cancer	neoplasm	Picropodophyllotoxin (NPC32373)	NP level
NCT01725555	A Study to Assess the Effect of Food on the Bioavailability of the IGF-1R Inhibitor AXL1717 in Patients With Advanced Malignant Tumors	lymphoid neoplasm	Picropodophyllotoxin (NPC32373)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	NPC1,HIF1A,PAX8,TUBB6,LMNA
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	HIF1A,PAX8,TUBB6,LMNA
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	SMN1,PAX8,TUBB6,LMNA
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	NPC1,SMN1,LMNA,PAX8
Atopic eczema Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA80	NR3C1,CYP3A4,NR3C1
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	CYP3A4,HIF1A,NR3C1
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	LMNA,TUBB6,RAB9A
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	LMNA,TUBB6,RAB9A
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	SMN1,HIF1A,RAB9A
Muscular atrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B61	SMN2,SMN1
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	CYP3A4,PAX8
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	HIF1A,LMNA
Renal cell carcinoma, chromophobe type Disease Category: X.Extension Codes Disease ICD-11 Code: XH6153	NPC1,CYP3A4
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	NR3C1,CYP3A4
Anxiety Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MB24.3	CYP3A4
Multiple sclerosis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A40	NR3C1
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	NR3C1
Substance abuse Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C40	NR3C1
Rheumatoid arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA20	NR3C1
Vitamin deficiency Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B55-5B5F	NR3C1
Chronic obstructive pulmonary disease Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA22	NR3C1
Retinopathy Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9B71	NR3C1
Oesophagitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA24	NR3C1
Adrenogenital disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A71	NR3C1
Mood disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A60-6E23	NR3C1
Vasomotor/allergic rhinitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA08	NR3C1
Mature T-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A90	HIF1A
Pulmonary hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BB01	HIF1A
Asthma Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA23	NR3C1
Adaptive immunity immunodeficiency Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A01	NR3C1
Cushing syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A70	NR3C1
Postoperative inflammation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-CA43	NR3C1
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	NR3C1
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	NR3C1
Muscular dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C70	NR3C1
Depression Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A70-6A7Z	NR3C1
Fungal infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F29-1F2F	RAB9A
Prostate cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82	NR3C1
Otitis externa Disease Category: 10.Diseases of the ear or mastoid process Disease ICD-11 Code: AA00-AA13	NR3C1
Adrenomedullary hyperfunction Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A75	HIF1A
Brain cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00	HIF1A
Herpes simplex infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F00	NR3C1
Indeterminate colitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD72	NR3C1
Spine/trunk injury Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: ND51	NR3C1
Allergic/hypersensitivity disorder Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A80-4A8Z	NR3C1
Gliosarcoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH9RC8	NCT01721577
Squamous cell carcinoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B60-2D01	NCT01561456
Non-small cell lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	NCT01466647
Anogenital warts Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A95	NCT03532776
Oligodendroglioma, anaplastic Disease Category: X.Extension Codes Disease ICD-11 Code: XH8844	NCT01721577
Astrocytoma, anaplastic Disease Category: X.Extension Codes Disease ICD-11 Code: XH96C7	NCT01721577
Neoplasms of haematopoietic or lymphoid tissues, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B3Z	NCT01725555
Neoplasms Disease Category: 02.Neoplasms Disease ICD-11 Code: 02	NCT01062620
Adenocarcinoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D40	NCT01561456
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	PAX8
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	NR3C1
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	PAX8
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	PAX8
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	CYP3A4
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	TUBB6

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Brickellia Pendula

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

104 All known Ingredients in Total

88 Ingredients with Acceptable Bioavailablity

25 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Adenocarcinoma of pancreas

Malignant neoplasms of biliary tract, distal bile duct

Diffuse large B-cell lymphomas

Mesothelioma of pleura

Atopic eczema

Solid tumour/cancer

Superficial ovarian endometriosis

Glioblastoma of brain

Germ cell tumour of testis

Muscular atrophy

Urothelial carcinoma of bladder

Chikungunya virus disease

Renal cell carcinoma, chromophobe type

Malignant neoplasms of adrenal gland

Anxiety

Multiple sclerosis

Type 2 diabetes mellitus

Substance abuse

Rheumatoid arthritis

Vitamin deficiency

Chronic obstructive pulmonary disease

Retinopathy

Oesophagitis

Adrenogenital disorder

Mood disorder

Vasomotor/allergic rhinitis

Mature T-cell lymphoma

Pulmonary hypertension

Asthma

Adaptive immunity immunodeficiency

Cushing syndrome

Postoperative inflammation

Acute diabete complication

Breast cancer

Muscular dystrophy

Depression

Fungal infection

Prostate cancer

Otitis externa

Adrenomedullary hyperfunction

Brain cancer

Herpes simplex infection

Indeterminate colitis

Spine/trunk injury

Allergic/hypersensitivity disorder

Gliosarcoma

Squamous cell carcinoma

Non-small cell lung cancer

Anogenital warts

Oligodendroglioma, anaplastic

Astrocytoma, anaplastic

Neoplasms of haematopoietic or lymphoid tissues, unspecified

Neoplasms

Adenocarcinoma

Carcinosarcoma of uterus

Pheochromocytoma

Hepatocellular carcinoma of liver

Malignant neoplasms of corpus uteri, unspecified

Malignant neoplasms of thymus

Carpal tunnel syndrome

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

>> Targets derived from weak experimental activities