• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Empetrum Nigrum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

GTGACCTGCGGAAGGATCATTGTCGAAAACCTGCCAAGAAGCACAAAACTCCCGAACTTGTCTAACATACAACGGGGATTGCGCGGGTTGGGGCCTAGGCCTCTTTCCCTTGCGCTCTCCCCCTCGCGAGTAGATGTTGGCGGAGCTTTCGGGCAACGTGTTCATTTACTCGTCGAACAACGAACCCCGGCGCAAAACGCGCCAAGGACAATTGAACAAAAGCTTGTGCACGCCCCCTTGCCTGTTTTCGGACGGCGTTGGCGTACACATCTTTCGAATGACTAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO19152
Plant Latin Name: Empetrum Nigrum
Taxonomy Genus: Empetrum
Taxonomy Family: Ericaceae

Plant External Links:

NCBI TaxonomyDB: 191066
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Finland

Traditional Medicine System:


Medicinal Functions:

Astringent; Diuretic; Kidney; Ophthalmic

Geographical Distribution

Finland

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

110 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


36 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

61 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC97444

Ingredient ID: NPC9634

Ingredient ID: NPC90769

Ingredient ID: NPC90740

Ingredient ID: NPC89880

Ingredient ID: NPC82847

Ingredient ID: NPC81698

Ingredient ID: NPC77719

Ingredient ID: NPC7095

Ingredient ID: NPC69394

Ingredient ID: NPC6332

Ingredient ID: NPC60548

Ingredient ID: NPC60509

Ingredient ID: NPC57030

Ingredient ID: NPC55887

Ingredient ID: NPC51700

Ingredient ID: NPC48568

Ingredient ID: NPC482007

Ingredient ID: NPC482006

Ingredient ID: NPC37454

Ingredient ID: NPC35659

Ingredient ID: NPC33695

Ingredient ID: NPC31801

Ingredient ID: NPC306799

Ingredient ID: NPC304876

Ingredient ID: NPC303454

Ingredient ID: NPC300414

Ingredient ID: NPC297186

Ingredient ID: NPC296250

Ingredient ID: NPC294902

Ingredient ID: NPC294555

Ingredient ID: NPC291416

Ingredient ID: NPC286206

Ingredient ID: NPC286146

Ingredient ID: NPC282054

Ingredient ID: NPC278768

Ingredient ID: NPC275861

Ingredient ID: NPC266489

Ingredient ID: NPC265395

Ingredient ID: NPC264317

Ingredient ID: NPC261969

Ingredient ID: NPC26033

Ingredient ID: NPC257213

Ingredient ID: NPC256142

Ingredient ID: NPC250696

Ingredient ID: NPC250046

Ingredient ID: NPC249983

Ingredient ID: NPC249657

Ingredient ID: NPC249471

Ingredient ID: NPC249375

Ingredient ID: NPC246778

Ingredient ID: NPC246620

Ingredient ID: NPC242262

Ingredient ID: NPC241278

Ingredient ID: NPC239827

Ingredient ID: NPC239502

Ingredient ID: NPC237549

Ingredient ID: NPC23250

Ingredient ID: NPC230929

Ingredient ID: NPC230301

Ingredient ID: NPC228204

Ingredient ID: NPC22519

Ingredient ID: NPC221482

Ingredient ID: NPC215932

Ingredient ID: NPC213552

Ingredient ID: NPC20791

Ingredient ID: NPC205522

Ingredient ID: NPC201562

Ingredient ID: NPC198539

Ingredient ID: NPC198455

Ingredient ID: NPC195727

Ingredient ID: NPC195202

Ingredient ID: NPC187861

Ingredient ID: NPC184045

Ingredient ID: NPC183542

Ingredient ID: NPC182869

Ingredient ID: NPC181148

Ingredient ID: NPC18074

Ingredient ID: NPC1786

Ingredient ID: NPC178177

Ingredient ID: NPC169749

Ingredient ID: NPC168799

Ingredient ID: NPC165260

Ingredient ID: NPC163699

Ingredient ID: NPC161239

Ingredient ID: NPC160951

Ingredient ID: NPC15917

Ingredient ID: NPC158333

Ingredient ID: NPC156913

Ingredient ID: NPC156139

Ingredient ID: NPC154819

Ingredient ID: NPC14958

Ingredient ID: NPC146307

Ingredient ID: NPC145379

Ingredient ID: NPC142415

Ingredient ID: NPC133217

Ingredient ID: NPC129546

Ingredient ID: NPC127857

Ingredient ID: NPC121712

Ingredient ID: NPC1173

Ingredient ID: NPC116775

Ingredient ID: NPC115400

Ingredient ID: NPC114410

Ingredient ID: NPC112523

Ingredient ID: NPC112216

Ingredient ID: NPC108824

Ingredient ID: NPC10776

Ingredient ID: NPC105925

Ingredient ID: NPC101475

Ingredient ID: NPC101043