CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Melilotus Messanensis

Example Image

PLANiTS DNA barcode

Click for details-----ITS

CCAACACGCGAATCAGTTCGAAAACACATGGGGGTGGGTTGAGGTGTTAACCACCTCCGCCTACCTCAGGTTCAGAGGTGGACGACTCGCGCGTTCTCCTTTGTGCCAAAAAACCAAACCCCGGCGCCGAATGCGTCAAGGAATTAAGAATTTGCTCTGAGCGCACCTGCATGGCACCGGAGACGGTGTTCGTGCGGGTTACGTTTTGACACATTATTATATAGAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAATGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAATGCAAGTTGCGCCCGAGGCCATTAGGTCGAGGGCACGTCTGCCTGGGCGTCACACATCGAAGCCTCTTGCCAATTATTACCTTTTAATAGAGGTATATTGTGCATGCTGGTGAATGTTGGCCTCCCGTGAGCTCTATTGTCTCATGGTTGGTTGAAAATCGAGACCTTGGTAGGGTGTGCCATGATAGATGGTGGTTGTGTGACCCACGAGAACCAGGATCATTTGCTGCCCTATTCAATTTGGGCTCTTTTACCCATATGCGTTTTGGTAAACGCTCGTG

Click for details-----ITS1

Click for details-----ITS2

Taxonomic Information

Plant ID: NPO18975
Plant Latin Name: Melilotus Messanensis
Taxonomy Genus: Melilotus
Taxonomy Family: Fabaceae

Plant External Links:

NCBI TaxonomyDB: 1279044
Plant-of-the-World-Online: n.a.

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

4 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

4 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

2 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC77890

Ingredient ID: NPC4257

Ingredient ID: NPC248599

Ingredient ID: NPC234822

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Structural protein	LMNA	Prelamin-A/C	P02545	CHEMBL1293235

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	12

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT04015414	Varenicline Versus Cytisine for Smoking Cessation in Primary Care Setting	smoking cessation	Cytisine (NPC77890)	NP level
NCT04126135	Comparative Effectiveness of Cystine Versus Nicotine Replacement Therapy	nicotine dependence	Cytisine (NPC77890)	NP level
NCT02957786	Cytisine Versus Varenicline for Smoking Cessation	smoking cessation	Cytisine (NPC77890)	NP level
NCT04576949	A Study of Cytisinicline for Smoking Cessation in Adult Smokers	smoking cessation	Cytisine (NPC77890)	NP level
NCT03848208	A Single Dose-escalation Study of Cytisine in Adult Smokers	smoking cessation	Cytisine (NPC77890)	NP level
NCT05311085	Cytisine and E-cigarettes With Supportive Text-messaging for Smoking Cessation (Cess@Tion)	smoking cessation	Cytisine (NPC77890)	NP level
NCT03709823	Trial of Cytisine in Adult Smokers	smoking cessation	Cytisine (NPC77890)	NP level
NCT02585024	Cytisine Pharmacokinetics and Dose Response (C-DRAKS 3 and C-DRAKS 4)	smoking cessation	Cytisine (NPC77890)	NP level
NCT03268343	A Study in Healthy Volunteers to Investigate the Effect of Food on the Bioavailability of Cytisine	smoking cessation	Cytisine (NPC77890)	NP level
NCT03509948	A Study in Healthy Smokers to Investigate the Effect of Food on the Bioavailability of Cytisine in a New Formulation	smoking cessation	Cytisine (NPC77890)	NP level
NCT05206370	A Second Study of Cytisinicline for Smoking Cessation in Adult Smokers	smoking cessation	Cytisine (NPC77890)	NP level
NCT03303911	A Pharmacokinetic and Pharmacodynamic Evaluation of Cytisine in Healthy Smokers	smoking cessation	Cytisine (NPC77890)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	CHRND,CHRNA4,CHRNA3
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	LMNA,CHRND,CHRNA3
Nicotine use disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C4A	CHRNA4 NCT04126135
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	CHRND,CHRNA3
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	CHRND,CHRNA3
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	CHRND,CHRNA3
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	LMNA,CHRNA3
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	LMNA,CHRNA3
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	CHRND,CHRNA3
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	CHRNA4,CHRNA3
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	LMNA,CHRNA4
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	CHRND,CHRNA4
Depression Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A70-6A7Z	CHRNA4
Irritable bowel syndrome Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD91	CHRNA4
Hypotension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA20-BA21	CHRNA4
Corneal disease Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9A76-9A78	CHRNA4
Digestive system disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DE2Z	CHRNA4
Mood disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A60-6E23	CHRNA4
Attention deficit hyperactivity disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A05	CHRNA4
Hypertensive crisis Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA03	CHRNA4
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	CHRNA4
Aneurysm/dissection Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD50	CHRNA4
Idiopathic pulmonary fibrosis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB03.4	CHRNA4
Myotonic dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C71.0	CHRND
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	LMNA
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	CHRND
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	LMNA
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	CHRND
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	CHRND
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	CHRNA4
Heart failure, unspecified Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD1Z	CHRNA3
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	LMNA
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	CHRNA3

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Melilotus Messanensis

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

4 All known Ingredients in Total

4 Ingredients with Acceptable Bioavailablity

2 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Carcinosarcoma of uterus

Malignant neoplasms of biliary tract, distal bile duct

Nicotine use disorder

Serous cystadenoma,borderline malignancy of ovary

Pheochromocytoma

Hepatoblastoma

Diffuse large B-cell lymphomas

Adenocarcinoma of pancreas

Hepatocellular carcinoma of liver

Cytomegaloviral disease

Chikungunya virus disease

Malignant neoplasms of adrenal gland

Depression

Irritable bowel syndrome

Hypotension

Corneal disease

Digestive system disease

Mood disorder

Attention deficit hyperactivity disorder

Hypertensive crisis

Alzheimer disease

Aneurysm/dissection

Idiopathic pulmonary fibrosis

Myotonic dystrophy

Mesothelioma of pleura

Other specified malignant neoplasms of kidney, except renal pelvis

Superficial ovarian endometriosis

Malignant neoplasms of corpus uteri, unspecified

Malignant neoplasms of thymus

Invasive carcinoma of breast

Heart failure, unspecified

Glioblastoma of brain

Germ cell tumour of testis

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

>> Targets derived from weak experimental activities