• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Ephedra Aphylla


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

NA

Click for details-----ITS2

ACCACAATTCGCCCCCCGGCTCATGTCGTCGGGGGGACGGCCTTGACCGTCCGGTCCGCCTCGGCGGTGCGGTCGGTTGAAATGCAAAAGGGGACCTTCGCATGCTCTCCGACGGGGGGAGGTTGCGCATCGCGGCCCGCTTCCCGGGAGGGGTCGCATCCGGCACCGACTGTGCGGGAGATGCTGCGTAAGGTTTCCCGATCGAAAAAGGACTTCACCAAAGGCGGGATTTATTCCCGTCGCAA
Taxonomic Information

Plant ID: NPO1897
Plant Latin Name: Ephedra Aphylla
Taxonomy Genus: Ephedra
Taxonomy Family: Ephedraceae

Plant External Links:

NCBI TaxonomyDB: 191304
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

63 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


28 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

25 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98143

Ingredient ID: NPC92815

Ingredient ID: NPC73615

Ingredient ID: NPC40593

Ingredient ID: NPC3413

Ingredient ID: NPC308229

Ingredient ID: NPC307773

Ingredient ID: NPC307063

Ingredient ID: NPC303187

Ingredient ID: NPC30259

Ingredient ID: NPC291454

Ingredient ID: NPC290598

Ingredient ID: NPC285773

Ingredient ID: NPC281774

Ingredient ID: NPC281131

Ingredient ID: NPC270023

Ingredient ID: NPC267753

Ingredient ID: NPC26536

Ingredient ID: NPC264879

Ingredient ID: NPC263964

Ingredient ID: NPC263130

Ingredient ID: NPC259933

Ingredient ID: NPC25761

Ingredient ID: NPC255164

Ingredient ID: NPC249415

Ingredient ID: NPC24335

Ingredient ID: NPC240429

Ingredient ID: NPC230701

Ingredient ID: NPC230463

Ingredient ID: NPC230301

Ingredient ID: NPC227152

Ingredient ID: NPC225434

Ingredient ID: NPC220705

Ingredient ID: NPC219953

Ingredient ID: NPC218161

Ingredient ID: NPC20791

Ingredient ID: NPC201888

Ingredient ID: NPC197666

Ingredient ID: NPC196781

Ingredient ID: NPC195912

Ingredient ID: NPC19240

Ingredient ID: NPC190218

Ingredient ID: NPC190204

Ingredient ID: NPC18955

Ingredient ID: NPC179950

Ingredient ID: NPC179488

Ingredient ID: NPC17745

Ingredient ID: NPC176766

Ingredient ID: NPC175793

Ingredient ID: NPC162742

Ingredient ID: NPC159245

Ingredient ID: NPC150147

Ingredient ID: NPC149203

Ingredient ID: NPC145778

Ingredient ID: NPC135954

Ingredient ID: NPC131840

Ingredient ID: NPC130011

Ingredient ID: NPC127365

Ingredient ID: NPC114101

Ingredient ID: NPC112692

Ingredient ID: NPC109071

Ingredient ID: NPC108962

Ingredient ID: NPC100433