• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Melia Azedarach


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GGGAATCATTGTCGAACCTGCCCAGCAGAACGACCCGCGAACTCGTAACAAAACTCGCGGGGGCGGGGCGACGCGGGCGCGAGCCCGCCGAGCCCGCTGCCCCCCGTCCGCCGCGGGGTCGAGACCCGTCTCGCACCCCCGCGGCGAAACAACGAACCCCGGCGCGAGCTGCGCCAAGGAAAATCAAACGAGAGAGCGCGCTCCCGGCGCCCCGGACACGGTGCGCGCCCGGGATGCGTCGCCTTCTTTCACCGAAATCCAAAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAATGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAATGCAAGTTGCGCCCGAGGCCATTAGGTCGAGGGCACGTCTGCCTGGGCGTCACACATCGTTGCCCCCCCGCACAATCCCCTCTCGGGGGAAGAGGTGTCGGGCGGGCGGAGACTGGCCTCCCGTGCGCTCCGCGCTCGCGGTTGGCCGAAATTCGAGTCCTTCGGCGACCGGGCCGCGACGATCGGTGGTGAGAACAAGCCTCTCGAGCTCCAGTCGCGCACCCGCGCCTCCGTGCGAGGGACTCGCGGACCCTTGTGCACGCCCCTCCGGGCGATGCTCGCTCGCGACCCCAGTCGGGGATACGTGGTTTAAGCATATCAATAAGCGGAGGA

Click for details-----ITS1

GGGAATCATTGTCGAACCTGCCCAGCAGAACGACCCGCGAACTCGTAACAAAACTCGCGGGGGCGGGGCGACGCGGGCGCGAGCCCGCCGAGCCCGCTGCCCCCCGTCCGCCGCGGGGTCGAGACCCGTCTCGCACCCCCGCGGCGAAACAACGAACCCCGGCGCGAGCTGCGCCAAGGAAAATCAAACGAGAGAGCGCGCTCCCGGCGCCCCGGACACGGTGCGCGCCCGGGATGCGTCGCCTTCTTTCACCGAAATCCAAAA

Click for details-----ITS2

ATCGTTGCCCCCCCGCACAATCCCCTCTCGGGGGAAGAGGTGTCGGGCGGGCGGAGACTGGCCTCCCGTGCGCTCCGCGCTCGCGGTTGGCCGAAATTCGAGTCCTTCGGCGACCGGGCCGCGACGATCGGTGGTGAGAACAAGCCTCTCGAGCTCCAGTCGCGCACCCGCGCCTCCGTGCGAGGGACTCGCGGACCCTTGTGCACGCCCCTCCGGGCGATGCTCGCTCGCGACCCCAGTCGGGGATACGTGGTTTAAGCATATCAATAAGCGGAGGA
Taxonomic Information

Plant ID: NPO18932
Plant Latin Name: Melia Azedarach
Taxonomy Genus: Melia
Taxonomy Family: Meliaceae

Plant External Links:

NCBI TaxonomyDB: 155640
Plant-of-the-World-Online: 578949-1

Used in Medicines

Country/Region:
South Africa; Tanzania; Indonesia; India; Rwanda; China; Thailand; Kenya; Argentina; Philippines

Traditional Medicine System:
Sowa-Rigpa; Indian Folk; Unani; Siddha; Ayurveda; TCM

Geographical Distribution

Brazil; Bangladesh; Sudan; Mali; Cambodia; France; Bahamas; Rwanda; Peru; Swaziland; Argentina; Bolivia; Vanuatu; Burkina Faso; Ecuador; Benin; Australia; Algeria; Cuba; El Salvador; Venezuela; Zambia; Cape Verde; Malawi; Togo; Trinidad and Tobago; Zimbabwe; China; Thailand; Dominican Republic; Belize; United States; Tanzania; Spain; Libya; Pakistan; Gambia; Philippines; Indonesia; New Caledonia; Mauritius; Morocco; Namibia; Kenya; Honduras; Haiti; Jamaica; Seychelles; Angola; Portugal; Chad; Mexico; Tunisia; South Africa; India; Lesotho; Mozambique; Uganda; Japan; Fiji; Botswana

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

263 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


142 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

108 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC97130

Ingredient ID: NPC95675

Ingredient ID: NPC94319

Ingredient ID: NPC94076

Ingredient ID: NPC92114

Ingredient ID: NPC910

Ingredient ID: NPC89422

Ingredient ID: NPC86939

Ingredient ID: NPC85813

Ingredient ID: NPC84713

Ingredient ID: NPC83157

Ingredient ID: NPC82902

Ingredient ID: NPC82050

Ingredient ID: NPC81933

Ingredient ID: NPC81917

Ingredient ID: NPC81010

Ingredient ID: NPC79892

Ingredient ID: NPC77334

Ingredient ID: NPC76145

Ingredient ID: NPC75073

Ingredient ID: NPC7491

Ingredient ID: NPC7468

Ingredient ID: NPC72722

Ingredient ID: NPC71905

Ingredient ID: NPC71853

Ingredient ID: NPC70744

Ingredient ID: NPC69097

Ingredient ID: NPC68357

Ingredient ID: NPC67788

Ingredient ID: NPC65765

Ingredient ID: NPC64434

Ingredient ID: NPC64370

Ingredient ID: NPC62692

Ingredient ID: NPC61769

Ingredient ID: NPC57877

Ingredient ID: NPC57089

Ingredient ID: NPC5642

Ingredient ID: NPC50462

Ingredient ID: NPC49151

Ingredient ID: NPC488539

Ingredient ID: NPC488538

Ingredient ID: NPC488537

Ingredient ID: NPC488536

Ingredient ID: NPC488535

Ingredient ID: NPC488534

Ingredient ID: NPC488533

Ingredient ID: NPC488532

Ingredient ID: NPC488531

Ingredient ID: NPC488530

Ingredient ID: NPC488529

Ingredient ID: NPC48840

Ingredient ID: NPC479081

Ingredient ID: NPC475641

Ingredient ID: NPC475237

Ingredient ID: NPC475226

Ingredient ID: NPC475066

Ingredient ID: NPC44369

Ingredient ID: NPC43263

Ingredient ID: NPC42461

Ingredient ID: NPC424

Ingredient ID: NPC41426

Ingredient ID: NPC4079

Ingredient ID: NPC39793

Ingredient ID: NPC39784

Ingredient ID: NPC39210

Ingredient ID: NPC36061

Ingredient ID: NPC35734

Ingredient ID: NPC35610

Ingredient ID: NPC34764

Ingredient ID: NPC34125

Ingredient ID: NPC33761

Ingredient ID: NPC3357

Ingredient ID: NPC33489

Ingredient ID: NPC32977

Ingredient ID: NPC329148

Ingredient ID: NPC324552

Ingredient ID: NPC322542

Ingredient ID: NPC321096

Ingredient ID: NPC320105

Ingredient ID: NPC319571

Ingredient ID: NPC307011

Ingredient ID: NPC305630

Ingredient ID: NPC304309

Ingredient ID: NPC304212

Ingredient ID: NPC302857

Ingredient ID: NPC301696

Ingredient ID: NPC301660

Ingredient ID: NPC299856

Ingredient ID: NPC29883

Ingredient ID: NPC297844

Ingredient ID: NPC297643

Ingredient ID: NPC297527

Ingredient ID: NPC29695

Ingredient ID: NPC296350

Ingredient ID: NPC295846

Ingredient ID: NPC294902

Ingredient ID: NPC291261

Ingredient ID: NPC290598

Ingredient ID: NPC290076

Ingredient ID: NPC289366

Ingredient ID: NPC288779

Ingredient ID: NPC28779

Ingredient ID: NPC287782

Ingredient ID: NPC286774

Ingredient ID: NPC286342

Ingredient ID: NPC282593

Ingredient ID: NPC28227

Ingredient ID: NPC282024

Ingredient ID: NPC279121

Ingredient ID: NPC27541

Ingredient ID: NPC274107

Ingredient ID: NPC273646

Ingredient ID: NPC273385

Ingredient ID: NPC272902

Ingredient ID: NPC272138

Ingredient ID: NPC27075

Ingredient ID: NPC269275

Ingredient ID: NPC267210

Ingredient ID: NPC267079

Ingredient ID: NPC266320

Ingredient ID: NPC265656

Ingredient ID: NPC264690

Ingredient ID: NPC262505

Ingredient ID: NPC26229

Ingredient ID: NPC261831

Ingredient ID: NPC259435

Ingredient ID: NPC257347

Ingredient ID: NPC254509

Ingredient ID: NPC254156

Ingredient ID: NPC252890

Ingredient ID: NPC252862

Ingredient ID: NPC252230

Ingredient ID: NPC250842

Ingredient ID: NPC250025

Ingredient ID: NPC248838

Ingredient ID: NPC246543

Ingredient ID: NPC242334

Ingredient ID: NPC241721

Ingredient ID: NPC240817

Ingredient ID: NPC238379

Ingredient ID: NPC236709

Ingredient ID: NPC236637

Ingredient ID: NPC236579

Ingredient ID: NPC236355

Ingredient ID: NPC235496

Ingredient ID: NPC234691

Ingredient ID: NPC234560

Ingredient ID: NPC233533

Ingredient ID: NPC231007

Ingredient ID: NPC230301

Ingredient ID: NPC229861

Ingredient ID: NPC229262

Ingredient ID: NPC228417

Ingredient ID: NPC228346

Ingredient ID: NPC226749

Ingredient ID: NPC225710

Ingredient ID: NPC22484

Ingredient ID: NPC224420

Ingredient ID: NPC224353

Ingredient ID: NPC22293

Ingredient ID: NPC222184

Ingredient ID: NPC220860

Ingredient ID: NPC216630

Ingredient ID: NPC216394

Ingredient ID: NPC216260

Ingredient ID: NPC215099

Ingredient ID: NPC214848

Ingredient ID: NPC214691

Ingredient ID: NPC214067

Ingredient ID: NPC212473

Ingredient ID: NPC212462

Ingredient ID: NPC210831

Ingredient ID: NPC209970

Ingredient ID: NPC20994

Ingredient ID: NPC209364

Ingredient ID: NPC20791

Ingredient ID: NPC207146

Ingredient ID: NPC203719

Ingredient ID: NPC202189

Ingredient ID: NPC200793

Ingredient ID: NPC198023

Ingredient ID: NPC195019

Ingredient ID: NPC192858

Ingredient ID: NPC192402

Ingredient ID: NPC191213

Ingredient ID: NPC190784

Ingredient ID: NPC19044

Ingredient ID: NPC189406

Ingredient ID: NPC186869

Ingredient ID: NPC185538

Ingredient ID: NPC185456

Ingredient ID: NPC182427

Ingredient ID: NPC181951

Ingredient ID: NPC18104

Ingredient ID: NPC179950

Ingredient ID: NPC179904

Ingredient ID: NPC176740

Ingredient ID: NPC175987

Ingredient ID: NPC173745

Ingredient ID: NPC172864

Ingredient ID: NPC171736

Ingredient ID: NPC170170

Ingredient ID: NPC169638

Ingredient ID: NPC167976

Ingredient ID: NPC167416

Ingredient ID: NPC167400

Ingredient ID: NPC165967

Ingredient ID: NPC16511

Ingredient ID: NPC164719

Ingredient ID: NPC163957

Ingredient ID: NPC16277

Ingredient ID: NPC161917

Ingredient ID: NPC16157

Ingredient ID: NPC161193

Ingredient ID: NPC160374

Ingredient ID: NPC159670

Ingredient ID: NPC158233

Ingredient ID: NPC157192

Ingredient ID: NPC156655

Ingredient ID: NPC156654

Ingredient ID: NPC154477

Ingredient ID: NPC154101

Ingredient ID: NPC153696

Ingredient ID: NPC152763

Ingredient ID: NPC151719

Ingredient ID: NPC149203

Ingredient ID: NPC149184

Ingredient ID: NPC14917

Ingredient ID: NPC146679

Ingredient ID: NPC146197

Ingredient ID: NPC145134

Ingredient ID: NPC140575

Ingredient ID: NPC139029

Ingredient ID: NPC13789

Ingredient ID: NPC136303

Ingredient ID: NPC132534

Ingredient ID: NPC131769

Ingredient ID: NPC128061

Ingredient ID: NPC126984

Ingredient ID: NPC126586

Ingredient ID: NPC125087

Ingredient ID: NPC123965

Ingredient ID: NPC121236

Ingredient ID: NPC118086

Ingredient ID: NPC117237

Ingredient ID: NPC116775

Ingredient ID: NPC114008

Ingredient ID: NPC113733

Ingredient ID: NPC111888

Ingredient ID: NPC111795

Ingredient ID: NPC107704

Ingredient ID: NPC1075

Ingredient ID: NPC106770

Ingredient ID: NPC106250

Ingredient ID: NPC105416

Ingredient ID: NPC104506

Ingredient ID: NPC104490

Ingredient ID: NPC101307

Ingredient ID: NPC101285

Ingredient ID: NPC101219

Ingredient ID: NPC100929

Ingredient ID: NPC100551

Ingredient ID: NPC1003