• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Piper Umbellatum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GTAGTGACCTGCGGATGATCATTGTTGATGCCTATCAAAAAAGATCCAAGAGAACTCGTAAGCCCTCGTTATTGGCCCGCACCCCCCTCTGCACGTGTCGGGCAACAACGAACCAAATCTCGGCGCAACACGCGCCAAGGAACTTACAAAGATTTGATTGCAGCCTCCTCCCCCCTATCGGGCTGGAGGGGGACTCATCGATCAGTTTAAAGTCAATACGACTCTCGGCAACGGATATCTCGGCTCTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGGCCTTTCGGTCGAGGGCACATCTGCTTGGGCGTTAAACAACTCGTCACCCCCCCACCTTCTCTCCCCGTACTCCGACCAAGGAGTCCGGGGGTAGACGACGGTAGGACGGGCGGAGTCTGGTCGTCCGTGTGGCTGCAGCGCACGCGGTTGGCTGAAAAACGAGGGCGATGAGCTGTGTGCGGCTCAACAAGTGGTGGTTGTGCGCCCTAAAGGCCGCGATTGTCAGCATGTTGAGCCCATCACTTCTCGATTGCCCGCGAGGCCCACACAATCGAAACATCCAACCCACGGATCGATTCGAATGCAACCCC

Click for details-----ITS1

GTAGTGACCTGCGGATGATCATTGTTGATGCCTATCAAAAAAGATCCAAGAGAACTCGTAAGCCCTCGTTATTGGCCCGCACCCCCCTCTGCACGTGTCGGGCAACAACGAACCAAATCTCGGCGCAACACGCGCCAAGGAACTTACAAAGATTTGATTGCAGCCTCCTCCCCCCTATCGGGCTGGAGGGGGACTCATCGATCAGTTTAAAGTCAATA

Click for details-----ITS2

AACTCGTCACCCCCCCCCACCTTCTCTCCCCATACTCCGACCAAGGAGTCCGGGGGCAGACGACGGTAGGATGGGCGGAGTCTGGTCGTCCGTGTGGCTGAAACGCACGCGGTTGGCTGAAAAACGAGGGCGATGGGCTGTGTGCGGCTCAACAAGTGGTGGTTGTGCGCCCCGAAGGCCGCGATTGTCAGCATGTTGAACCCATCACTTCTCGATTGCCCTGCGAGGACCCAACACAATCGAAACATCCAACCCACGGATCGATTCGAATTGCA
Taxonomic Information

Plant ID: NPO18911
Plant Latin Name: Piper Umbellatum
Taxonomy Genus: Piper
Taxonomy Family: Piperaceae

Plant External Links:

NCBI TaxonomyDB: 130418
Plant-of-the-World-Online: 316339-2

Used in Medicines

Country/Region:
Ghana; Kenya; Tanzania; Rwanda; China

Traditional Medicine System:
TCM

Geographical Distribution

Brazil; Sudan; Guinea; Costa Rica; Ethiopia; Rwanda; Peru; Nigeria; Bolivia; Cameroon; Cote d'Ivoire; Ecuador; Ghana; Cuba; Venezuela; Malawi; Togo; Zimbabwe; China; Haiti; Belize; Sierra Leone; Liberia; Uganda; Tanzania; Mauritius; Trinidad and Tobago; Gabon; Honduras; Dominican Republic; Jamaica; Seychelles; Angola; Mexico; Congo; Mozambique; Colombia; Burundi; Kenya

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

13 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


13 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

7 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC79513

Ingredient ID: NPC59551

Ingredient ID: NPC274730

Ingredient ID: NPC272721

Ingredient ID: NPC264310

Ingredient ID: NPC257298

Ingredient ID: NPC236428

Ingredient ID: NPC222579

Ingredient ID: NPC186397

Ingredient ID: NPC184234

Ingredient ID: NPC169479

Ingredient ID: NPC156654

Ingredient ID: NPC105157