• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Aconitum Contortum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

NA

Click for details-----ITS2

ACAGCGTCGCACCCCGTCAACCACGTTGTCGGGGAGCGGAGATTGGCCCCCCGGCCCCCTGCGGGCACGGTCGGCACAAATGTTTGTCCTCGGCGACGAGCGTCGCGGTCAGTGGTGGTTGTATCTCTCATCCTCCAAAGACATCAAGACGCGTCGTCCTCGTTGCATGTTGGGACACATCGACCCCACGGAGCCGCTTCGCACGGC
Taxonomic Information

Plant ID: NPO18875
Plant Latin Name: Aconitum Contortum
Taxonomy Genus: Aconitum
Taxonomy Family: Ranunculaceae

Plant External Links:

NCBI TaxonomyDB: 226102
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

88 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


78 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

39 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99445

Ingredient ID: NPC96484

Ingredient ID: NPC95701

Ingredient ID: NPC94818

Ingredient ID: NPC93699

Ingredient ID: NPC86324

Ingredient ID: NPC86268

Ingredient ID: NPC84790

Ingredient ID: NPC81615

Ingredient ID: NPC78540

Ingredient ID: NPC710

Ingredient ID: NPC61773

Ingredient ID: NPC60951

Ingredient ID: NPC53877

Ingredient ID: NPC46206

Ingredient ID: NPC36061

Ingredient ID: NPC309697

Ingredient ID: NPC307815

Ingredient ID: NPC305986

Ingredient ID: NPC294578

Ingredient ID: NPC294548

Ingredient ID: NPC294230

Ingredient ID: NPC292832

Ingredient ID: NPC28685

Ingredient ID: NPC281138

Ingredient ID: NPC274995

Ingredient ID: NPC274248

Ingredient ID: NPC271276

Ingredient ID: NPC271240

Ingredient ID: NPC266193

Ingredient ID: NPC264803

Ingredient ID: NPC263582

Ingredient ID: NPC262561

Ingredient ID: NPC261831

Ingredient ID: NPC257666

Ingredient ID: NPC255170

Ingredient ID: NPC253455

Ingredient ID: NPC251475

Ingredient ID: NPC247586

Ingredient ID: NPC247524

Ingredient ID: NPC245795

Ingredient ID: NPC24491

Ingredient ID: NPC244790

Ingredient ID: NPC243728

Ingredient ID: NPC243083

Ingredient ID: NPC242211

Ingredient ID: NPC241838

Ingredient ID: NPC241337

Ingredient ID: NPC230301

Ingredient ID: NPC229497

Ingredient ID: NPC224493

Ingredient ID: NPC223114

Ingredient ID: NPC215914

Ingredient ID: NPC214280

Ingredient ID: NPC208791

Ingredient ID: NPC20573

Ingredient ID: NPC203829

Ingredient ID: NPC203674

Ingredient ID: NPC197114

Ingredient ID: NPC188344

Ingredient ID: NPC185444

Ingredient ID: NPC182420

Ingredient ID: NPC180203

Ingredient ID: NPC178852

Ingredient ID: NPC171450

Ingredient ID: NPC17052

Ingredient ID: NPC169941

Ingredient ID: NPC169275

Ingredient ID: NPC168514

Ingredient ID: NPC16828

Ingredient ID: NPC165967

Ingredient ID: NPC163624

Ingredient ID: NPC163296

Ingredient ID: NPC162236

Ingredient ID: NPC161788

Ingredient ID: NPC156654

Ingredient ID: NPC152042

Ingredient ID: NPC135294

Ingredient ID: NPC134609

Ingredient ID: NPC132065

Ingredient ID: NPC130017

Ingredient ID: NPC127582

Ingredient ID: NPC127447

Ingredient ID: NPC120104

Ingredient ID: NPC110150

Ingredient ID: NPC10855

Ingredient ID: NPC104565

Ingredient ID: NPC103308