• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Hyoscyamus Niger


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCACAGCAGAACGACCCGCGAACACGTTCAAACACCGGCTGGCCGAGCGGGCTGGTCCCGACCGGCACGCCTCCGTCCCCCGGCGGGGCGGCTAACGAACCCCGGCGCGGAAAGCGCCAAGGAATACTGAACTGATCGGCCTGCCCTCCCGCGCCCCGTCCGCGGCGCGCGCGGGGGGAGCTGCGCCTGTCTTGAAACCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCTCCTCGCCCGCGGGCGAACGAGGGGCGGATACTGGCCTCCCGTGCGCCCCCGCGCGCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGCGACCCAACTCTCGTCGTGCCGCGACGGCGTCCCGTCGCGCGTCCGGACTCCGGACCCTCATGATAAGCGCTCGTAACAAGCGCTCCGA

Click for details-----ITS1

TCGAAACCTGCACAGCAGAACGACCCGCGAACACGTTCAAACACCGGCTGGCCGAGCGGGCTGGTCCCGACCGGCACGCCTCCGTCCCCCGGCGGGGCGGCTAACGAACCCCGGCGCGGAAAGCGCCAAGGAATACTGAACTGATCGGCCTGCCCTCCCGCGCCCCGTCCGCGGCGCGCGCGGGGGGAGCTGCGCCTGTCTTGAAACCAAAA

Click for details-----ITS2

ATCGCGTCGCCCCTCCTCGCCCGCGGGCGAACGAGGGGCGGATACTGGCCTCCCGTGCGCCCCCGCGCGCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGCGACCCAACTCTCGTCGTGCCGCGACGGCGTCCCGTCGCGCGTCCGGACTCCGGACCCTCATGATAAGCGCTCGTAACAAGCGCTCCGACCGCGACC
Taxonomic Information

Plant ID: NPO18781
Plant Latin Name: Hyoscyamus Niger
Taxonomy Genus: Hyoscyamus
Taxonomy Family: Solanaceae

Plant External Links:

NCBI TaxonomyDB: 4079
Plant-of-the-World-Online: 815932-1

Used in Medicines

Country/Region:
Turkey; Italy; Finland; India; China; Bulgaria

Traditional Medicine System:
Unani; TCM; Homeopathy; Ayurveda; Siddha


Medicinal Functions:

Anodyne; Anthelmintic; Antispasmodic; Antitumor; Diuretic; Febrifuge; Hallucinogenic; Hypnotic; Mydriatic; Narcotic; Sedative

Geographical Distribution

Turkey; Afghanistan; Italy; Turkmenistan; Nepal; Mongolia; France; Ireland; Norway; Uzbekistan; Australia; Iran; Algeria; China; Belgium; Germany; Iraq; Kazakhstan; Spain; Ukraine; Netherlands; Denmark; Poland; Finland; United States; Morocco; Sweden; Belarus; Japan; Switzerland; New Zealand; Russia; Bulgaria; Pakistan; Romania; Albania; Portugal; Myanmar; South Africa; Tunisia; India; United Kingdom; Austria; Greece; Hungary; Tajikistan

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

83 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


64 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

25 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC97820

Ingredient ID: NPC97212

Ingredient ID: NPC93433

Ingredient ID: NPC92146

Ingredient ID: NPC90984

Ingredient ID: NPC85811

Ingredient ID: NPC84281

Ingredient ID: NPC83062

Ingredient ID: NPC80851

Ingredient ID: NPC69699

Ingredient ID: NPC69496

Ingredient ID: NPC55285

Ingredient ID: NPC54511

Ingredient ID: NPC53463

Ingredient ID: NPC475443

Ingredient ID: NPC473829

Ingredient ID: NPC473559

Ingredient ID: NPC4683

Ingredient ID: NPC46780

Ingredient ID: NPC40005

Ingredient ID: NPC36609

Ingredient ID: NPC33541

Ingredient ID: NPC330426

Ingredient ID: NPC328960

Ingredient ID: NPC327013

Ingredient ID: NPC324403

Ingredient ID: NPC323787

Ingredient ID: NPC310904

Ingredient ID: NPC295983

Ingredient ID: NPC291027

Ingredient ID: NPC287708

Ingredient ID: NPC273260

Ingredient ID: NPC270278

Ingredient ID: NPC267466

Ingredient ID: NPC265160

Ingredient ID: NPC261831

Ingredient ID: NPC255452

Ingredient ID: NPC248142

Ingredient ID: NPC242162

Ingredient ID: NPC234378

Ingredient ID: NPC233910

Ingredient ID: NPC227451

Ingredient ID: NPC222039

Ingredient ID: NPC218109

Ingredient ID: NPC216630

Ingredient ID: NPC211401

Ingredient ID: NPC209970

Ingredient ID: NPC209773

Ingredient ID: NPC209596

Ingredient ID: NPC204385

Ingredient ID: NPC203064

Ingredient ID: NPC200302

Ingredient ID: NPC195749

Ingredient ID: NPC194435

Ingredient ID: NPC193830

Ingredient ID: NPC190558

Ingredient ID: NPC181153

Ingredient ID: NPC17936

Ingredient ID: NPC178263

Ingredient ID: NPC176599

Ingredient ID: NPC173810

Ingredient ID: NPC172518

Ingredient ID: NPC171551

Ingredient ID: NPC169485

Ingredient ID: NPC166179

Ingredient ID: NPC161229

Ingredient ID: NPC154165

Ingredient ID: NPC153413

Ingredient ID: NPC151003

Ingredient ID: NPC146197

Ingredient ID: NPC142753

Ingredient ID: NPC142458

Ingredient ID: NPC140302

Ingredient ID: NPC135174

Ingredient ID: NPC132923

Ingredient ID: NPC131969

Ingredient ID: NPC126878

Ingredient ID: NPC124626

Ingredient ID: NPC120426

Ingredient ID: NPC118353

Ingredient ID: NPC117351

Ingredient ID: NPC116631

Ingredient ID: NPC100478