• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Artemisia Scoparia


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TACGAATTGGAAATTTCTGGAACCCTGWAAAGCAGATCSACCCGTGAACGCKTAAAAACAACTGAGTGTCGTTAGGATCAAGCGCTCGTTTGATCCTCTCGACGCTCTGCCGATGTGCGTTCCCTCSAGTTCTTCTGGACCTCGTGTGAATGTCGTCGGCGCAATAACAACCCCCGGCACAATGTGTGCCAAGGAAAACTAAACTCAAGAAGGCTCGTTTCGTGTAGCCCCGTTCGCGGTGCGCTCATGGGACGCGGYTTCTTTATAATCACAAACGACTCTCGGCAACGGATATCTCGGCTCAYGCATCGATAAAGAACGTAGCAAAATGCGATACTTGGTGTAAATTGCAGAATCCCGTGAACCATCGAGTTTTAGAACWCAAGTTGCGCCCGAAGCCTTTTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGSGTCGCCCCCCACAAATTCTCCGTCAGGGGAGSTTGTGTYTCGGGGGCGGATACTGGTCTCCCGTGCTCATGGCGCGGTTGGCCGAAATAGGAGTCCCTTCGATGGACGCACGAACTAGWGGWGGTCGTAAAAACCCTCGTCTTTTGTTTCGTGCCGTTAGTTGCTAGGGAAGCTCTTTAAAAACCCCAKCGCGTSGTCTCTKGTMAGCGCTTCGACCGCGACCCGCATCGT

Click for details-----ITS1

TACGAATTGGAAATTTCTGGAACCCTGWAAAGCAGATCSACCCGTGAACGCKTAAAAACAACTGAGTGTCGTTAGGATCAAGCGCTCGTTTGATCCTCTCGACGCTCTGCCGATGTGCGTTCCCTCSAGTTCTTCTGGACCTCGTGTGAATGTCGTCGGCGCAATAACAACCCCCGGCACAATGTGTGCCAAGGAAAACTAAACTCAAGAAGGCTCGTTTCGTGTAGCCCCGTTCGCGGTGCGCTCATGGGACGCGGYTTCTTTATAATCACAAA

Click for details-----ITS2

ATCGSGTCGCCCCCCACAAATTCTCCGTCAGGGGAGSTTGTGTYTCGGGGGCGGATACTGGTCTCCCGTGCTCATGGCGCGGTTGGCCGAAATAGGAGTCCCTTCGATGGACGCACGAACTAGWGGWGGTCGTAAAAACCCTCGTCTTTTGTTTCGTGCCGTTAGTTGCTAGGGAAGCTCTTTAAAAACCCCAKCGCGTSGTCTCTKGTMAGCGCTTCGACCGCGACCCGCATCGT
Taxonomic Information

Plant ID: NPO18681
Plant Latin Name: Artemisia Scoparia
Taxonomy Genus: Artemisia
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: 72351
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China; India

Traditional Medicine System:
Indian Folk; TCM


Medicinal Functions:

Antibacterial; Anticholesterolemic; Antipyretic; Antiseptic; Cholagogue; Diuretic; Vasodilator

Geographical Distribution

India; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

132 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


116 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

64 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC92869

Ingredient ID: NPC88566

Ingredient ID: NPC82843

Ingredient ID: NPC81775

Ingredient ID: NPC80500

Ingredient ID: NPC78551

Ingredient ID: NPC76336

Ingredient ID: NPC7568

Ingredient ID: NPC6984

Ingredient ID: NPC68492

Ingredient ID: NPC66906

Ingredient ID: NPC64176

Ingredient ID: NPC63121

Ingredient ID: NPC62086

Ingredient ID: NPC58970

Ingredient ID: NPC52961

Ingredient ID: NPC51758

Ingredient ID: NPC49507

Ingredient ID: NPC47946

Ingredient ID: NPC45336

Ingredient ID: NPC44751

Ingredient ID: NPC39927

Ingredient ID: NPC3779

Ingredient ID: NPC37479

Ingredient ID: NPC36108

Ingredient ID: NPC329294

Ingredient ID: NPC329041

Ingredient ID: NPC328358

Ingredient ID: NPC326471

Ingredient ID: NPC326143

Ingredient ID: NPC325044

Ingredient ID: NPC324655

Ingredient ID: NPC320738

Ingredient ID: NPC320649

Ingredient ID: NPC317130

Ingredient ID: NPC312132

Ingredient ID: NPC311988

Ingredient ID: NPC303153

Ingredient ID: NPC302857

Ingredient ID: NPC301950

Ingredient ID: NPC294902

Ingredient ID: NPC289388

Ingredient ID: NPC288932

Ingredient ID: NPC287331

Ingredient ID: NPC283790

Ingredient ID: NPC28002

Ingredient ID: NPC279418

Ingredient ID: NPC276465

Ingredient ID: NPC276009

Ingredient ID: NPC274261

Ingredient ID: NPC271118

Ingredient ID: NPC270077

Ingredient ID: NPC269023

Ingredient ID: NPC267205

Ingredient ID: NPC26600

Ingredient ID: NPC257124

Ingredient ID: NPC25495

Ingredient ID: NPC254848

Ingredient ID: NPC254847

Ingredient ID: NPC24824

Ingredient ID: NPC246165

Ingredient ID: NPC245552

Ingredient ID: NPC242905

Ingredient ID: NPC241784

Ingredient ID: NPC241341

Ingredient ID: NPC240722

Ingredient ID: NPC240492

Ingredient ID: NPC239037

Ingredient ID: NPC232440

Ingredient ID: NPC231738

Ingredient ID: NPC23049

Ingredient ID: NPC226511

Ingredient ID: NPC225221

Ingredient ID: NPC221120

Ingredient ID: NPC22098

Ingredient ID: NPC220171

Ingredient ID: NPC219017

Ingredient ID: NPC218109

Ingredient ID: NPC217226

Ingredient ID: NPC216092

Ingredient ID: NPC214610

Ingredient ID: NPC214608

Ingredient ID: NPC206093

Ingredient ID: NPC205003

Ingredient ID: NPC204838

Ingredient ID: NPC198658

Ingredient ID: NPC198549

Ingredient ID: NPC198031

Ingredient ID: NPC197356

Ingredient ID: NPC195620

Ingredient ID: NPC194626

Ingredient ID: NPC190810

Ingredient ID: NPC1901

Ingredient ID: NPC187922

Ingredient ID: NPC187880

Ingredient ID: NPC180968

Ingredient ID: NPC180871

Ingredient ID: NPC180840

Ingredient ID: NPC178638

Ingredient ID: NPC177112

Ingredient ID: NPC176589

Ingredient ID: NPC176300

Ingredient ID: NPC173996

Ingredient ID: NPC172204

Ingredient ID: NPC170526

Ingredient ID: NPC167976

Ingredient ID: NPC165651

Ingredient ID: NPC165017

Ingredient ID: NPC163984

Ingredient ID: NPC162737

Ingredient ID: NPC162089

Ingredient ID: NPC158306

Ingredient ID: NPC153046

Ingredient ID: NPC14930

Ingredient ID: NPC143799

Ingredient ID: NPC143586

Ingredient ID: NPC142703

Ingredient ID: NPC13991

Ingredient ID: NPC139548

Ingredient ID: NPC138347

Ingredient ID: NPC138113

Ingredient ID: NPC137937

Ingredient ID: NPC13789

Ingredient ID: NPC131524

Ingredient ID: NPC128550

Ingredient ID: NPC125935

Ingredient ID: NPC120163

Ingredient ID: NPC117257

Ingredient ID: NPC114519

Ingredient ID: NPC110789

Ingredient ID: NPC106250

Ingredient ID: NPC100551