• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Juglans Regia


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGATACCTGCCCAGCAGAACGACCTGTGAACATGTAATAACCTTCTGGGTGGGGGTGTAATGCCCCCTCCCAAAAAACGGTTGGGAGGGCACGTTGAGATATGCCCACCGCTCCTCGTGTGTGGTTGGTCAATCTTCTCGTTCCCTTCCCGATCGAACAATGAACCCCGGCGCGGTCTGCGCCAAGGAACTTAAACAAGGAGTAACCACGGGCGCCCCGGAAACGGTGTGCGCGTTGTTGGTGACATCTTTACCATGATACATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTGCCCCAACCCCAAACACTTCTTATGATGTGTGGGGTGCGGGGAAGACATTGGCCTCCCGTGTGCTTCTGCTCGCGGTTAGCCTAAAAGTGAGTCCTAGGCGACGAGCGACGCGACAATCGGTGGTTGAGAAAACCTTATGACCCCGGTCGGGGGTAGCCCCCCCCGGGAAGGGTTTTCCTAGATCTTTTCGGGTGTGTGGGTGTGGGGCCCTGCCCCCGAAACGTTATCCTAGGCGGGATTACCCGCTGAATTTAAGCATATCAATAAGCGGG

Click for details-----ITS1

AAAGTCGTAACAAGGTTTCCGTAGGGCAACCCGATGCAGGATAATTGTCGATACGTGCCCAGCAGAACGACCTGTGAACATGTAATAACCTTCTGGGTGGGGGTGTAATGCCCCCTCCCAAAAAACGGTTGGGAGGGCACGTTGAGATATGCCCACCGCTCCTCGTGTGTGGTTGGTCAATCTTCTCGTTCCCTTCCCGATCGAACAATGAACCCCGGCGCGGTCTGCGCCAAGGAACTTAAACAAGGAGTAACCACGGGCGCCCCGGAAACGGTGTGCGCGTTGTTGGTGACATCTTTACCATGATACATAA

Click for details-----ITS2

ATCGTTGCCCCAACCCCAAACACTTCTTATGATGTGTGGGGTGCGGGGAAGACATTGGCCTCCCGTGTGCTTCTGCTCGCGGTTAGCCTAAAAGTGAGTCCTAGGCGACGAGCGACGCGACAATCGGTGGTTGAGAAAACCTTATGACCCCGGTCGGGGGTAGCCCCCCCCGGGAAGGGTTTTCCTAGATCTTTTCGGGTGTGTGGGTGTGGGGCCCTGCCCCCGAAACGTTATCCTAGGCGGGATTACCCGCTGAATTTAAGCATATCAATAAGCGGG
Taxonomic Information

Plant ID: NPO18674
Plant Latin Name: Juglans Regia
Taxonomy Genus: Juglans
Taxonomy Family: Juglandaceae

Plant External Links:

NCBI TaxonomyDB: 51240
Plant-of-the-World-Online: 442427-1

Used in Medicines

Country/Region:
Turkey; Israel; Italy; Portugal; Lebanon; India; Jordan; Chile; China; Argentina; Iraq; Spain

Traditional Medicine System:
Sowa-Rigpa; Indian Folk; Unani; Siddha; Ayurveda; TCM; Homeopathy


Medicinal Functions:

Alterative; Anodyne; Antiinflammatory; Astringent; Bach; Blood purifier; Cancer; Depurative; Detergent; Diuretic; Laxative; Lithontripic; Miscellany; Pectoral; Skin; Stimulant; Vermifuge

Geographical Distribution

Turkey; Italy; India; Nepal; France; Argentina; Israel; Algeria; Jordan; Chile; Belgium; China; Iraq; Spain; Ukraine; Libya; Morocco; Switzerland; Russia; Bulgaria; Romania; Albania; Portugal; Mexico; Tunisia; South Africa; Lebanon; United Kingdom; Austria; Greece; Hungary

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

213 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


124 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

123 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99734

Ingredient ID: NPC96286

Ingredient ID: NPC95615

Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC92774

Ingredient ID: NPC91114

Ingredient ID: NPC8793

Ingredient ID: NPC85813

Ingredient ID: NPC81010

Ingredient ID: NPC74539

Ingredient ID: NPC73143

Ingredient ID: NPC71460

Ingredient ID: NPC68670

Ingredient ID: NPC68492

Ingredient ID: NPC67250

Ingredient ID: NPC67037

Ingredient ID: NPC65562

Ingredient ID: NPC64434

Ingredient ID: NPC62045

Ingredient ID: NPC6095

Ingredient ID: NPC59650

Ingredient ID: NPC5891

Ingredient ID: NPC56699

Ingredient ID: NPC56145

Ingredient ID: NPC55412

Ingredient ID: NPC54925

Ingredient ID: NPC5326

Ingredient ID: NPC490427

Ingredient ID: NPC490424

Ingredient ID: NPC489908

Ingredient ID: NPC489907

Ingredient ID: NPC488382

Ingredient ID: NPC488381

Ingredient ID: NPC488380

Ingredient ID: NPC488379

Ingredient ID: NPC488378

Ingredient ID: NPC488377

Ingredient ID: NPC488376

Ingredient ID: NPC488375

Ingredient ID: NPC488374

Ingredient ID: NPC488373

Ingredient ID: NPC488372

Ingredient ID: NPC488371

Ingredient ID: NPC488370

Ingredient ID: NPC488369

Ingredient ID: NPC488368

Ingredient ID: NPC488367

Ingredient ID: NPC488366

Ingredient ID: NPC488365

Ingredient ID: NPC48623

Ingredient ID: NPC45663

Ingredient ID: NPC44260

Ingredient ID: NPC43945

Ingredient ID: NPC424

Ingredient ID: NPC39426

Ingredient ID: NPC35699

Ingredient ID: NPC32977

Ingredient ID: NPC328680

Ingredient ID: NPC328447

Ingredient ID: NPC32817

Ingredient ID: NPC327254

Ingredient ID: NPC323909

Ingredient ID: NPC322714

Ingredient ID: NPC321447

Ingredient ID: NPC321320

Ingredient ID: NPC320323

Ingredient ID: NPC319252

Ingredient ID: NPC318804

Ingredient ID: NPC317480

Ingredient ID: NPC317429

Ingredient ID: NPC317120

Ingredient ID: NPC31034

Ingredient ID: NPC307963

Ingredient ID: NPC307670

Ingredient ID: NPC304309

Ingredient ID: NPC302857

Ingredient ID: NPC301585

Ingredient ID: NPC300326

Ingredient ID: NPC299010

Ingredient ID: NPC295644

Ingredient ID: NPC294902

Ingredient ID: NPC294548

Ingredient ID: NPC293344

Ingredient ID: NPC290613

Ingredient ID: NPC29

Ingredient ID: NPC288963

Ingredient ID: NPC28657

Ingredient ID: NPC285989

Ingredient ID: NPC285893

Ingredient ID: NPC285829

Ingredient ID: NPC285196

Ingredient ID: NPC284285

Ingredient ID: NPC282229

Ingredient ID: NPC282120

Ingredient ID: NPC281972

Ingredient ID: NPC281686

Ingredient ID: NPC281131

Ingredient ID: NPC280905

Ingredient ID: NPC280749

Ingredient ID: NPC274613

Ingredient ID: NPC272614

Ingredient ID: NPC269980

Ingredient ID: NPC269919

Ingredient ID: NPC269440

Ingredient ID: NPC265305

Ingredient ID: NPC264779

Ingredient ID: NPC264537

Ingredient ID: NPC261831

Ingredient ID: NPC257124

Ingredient ID: NPC250769

Ingredient ID: NPC243509

Ingredient ID: NPC242580

Ingredient ID: NPC239067

Ingredient ID: NPC237812

Ingredient ID: NPC23622

Ingredient ID: NPC235751

Ingredient ID: NPC233827

Ingredient ID: NPC230301

Ingredient ID: NPC226453

Ingredient ID: NPC225710

Ingredient ID: NPC223727

Ingredient ID: NPC221144

Ingredient ID: NPC220765

Ingredient ID: NPC217781

Ingredient ID: NPC217649

Ingredient ID: NPC216630

Ingredient ID: NPC216297

Ingredient ID: NPC215894

Ingredient ID: NPC215008

Ingredient ID: NPC209970

Ingredient ID: NPC208793

Ingredient ID: NPC208553

Ingredient ID: NPC203468

Ingredient ID: NPC201284

Ingredient ID: NPC200872

Ingredient ID: NPC200684

Ingredient ID: NPC200561

Ingredient ID: NPC20045

Ingredient ID: NPC199072

Ingredient ID: NPC198658

Ingredient ID: NPC196924

Ingredient ID: NPC19620

Ingredient ID: NPC193694

Ingredient ID: NPC189438

Ingredient ID: NPC188428

Ingredient ID: NPC187993

Ingredient ID: NPC187770

Ingredient ID: NPC187605

Ingredient ID: NPC187262

Ingredient ID: NPC185755

Ingredient ID: NPC18335

Ingredient ID: NPC179037

Ingredient ID: NPC178134

Ingredient ID: NPC17810

Ingredient ID: NPC174246

Ingredient ID: NPC174213

Ingredient ID: NPC173638

Ingredient ID: NPC172419

Ingredient ID: NPC171736

Ingredient ID: NPC170960

Ingredient ID: NPC169749

Ingredient ID: NPC168707

Ingredient ID: NPC1682

Ingredient ID: NPC167400

Ingredient ID: NPC166525

Ingredient ID: NPC165257

Ingredient ID: NPC164646

Ingredient ID: NPC164329

Ingredient ID: NPC162742

Ingredient ID: NPC159334

Ingredient ID: NPC15912

Ingredient ID: NPC158147

Ingredient ID: NPC157338

Ingredient ID: NPC156654

Ingredient ID: NPC156461

Ingredient ID: NPC152451

Ingredient ID: NPC150950

Ingredient ID: NPC149184

Ingredient ID: NPC148215

Ingredient ID: NPC147983

Ingredient ID: NPC146197

Ingredient ID: NPC142770

Ingredient ID: NPC14079

Ingredient ID: NPC13914

Ingredient ID: NPC137958

Ingredient ID: NPC136814

Ingredient ID: NPC136785

Ingredient ID: NPC136188

Ingredient ID: NPC136014

Ingredient ID: NPC134847

Ingredient ID: NPC130683

Ingredient ID: NPC128410

Ingredient ID: NPC128030

Ingredient ID: NPC126791

Ingredient ID: NPC126759

Ingredient ID: NPC126681

Ingredient ID: NPC124530

Ingredient ID: NPC122414

Ingredient ID: NPC121817

Ingredient ID: NPC121372

Ingredient ID: NPC120649

Ingredient ID: NPC120635

Ingredient ID: NPC116474

Ingredient ID: NPC11433

Ingredient ID: NPC113914

Ingredient ID: NPC113733

Ingredient ID: NPC113665

Ingredient ID: NPC113212

Ingredient ID: NPC112890

Ingredient ID: NPC110899

Ingredient ID: NPC109221

Ingredient ID: NPC108288