• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Tectona Grandis


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TGTCGAGACCCGCAAAAGCAGACCGCGAACCCGTGCCCGACCGCACGGGGGCAGCGGCGCGGGGGCGCGCCCCCCGCCGCGGCCCCTCCTCCCGCCGGCGGGCGCGCGAGAGCGCCCCGCCGCGCGGGCTAACGAACCCCGGCGCGGCACGCGCCAAGGAAAACTCAACGTAGAGTCCGCCCCCCGACGCACCGTCCGCGGAGCGCGCGGGGGGACGGGTCGTCTATCGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCGTCAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCTCCCGCGCGCACGGCGCCGGCGAGGGGGGCGGAGATTGGCCTCCCGTGCGCCCCGGCGCGCGGCCGGCCCAAATGCGATCCCCCGACGGCGCACGTCGCGACCAGTGGTGGTTGAACACGAACGTCAACTCTCGTGCTGTCGCGGCCCGTCCGCTCGGGGAGATCACCGCATCGACCCAAACGGCGCTCCGGCGCCTCCGA

Click for details-----ITS1

TGTCGAGACCCGCAAAAGCAGACCGCGAACCCGTGCCCGACCGCACGGGGGCAGCGGCGCGGGGGCGCGCCCCCCGCCGCGGCCCCTCCTCCCGCCGGCGGGCGCGCGAGAGCGCCCCGCCGCGCGGGCTAACGAACCCCGGCGCGGCACGCGCCAAGGAAAACTCAACGTAGAGTCCGCCCCCCGACGCACCGTCCGCGGAGCGCGCGGGGGGACGGGTCGTCTATCGAATGTCAAAA

Click for details-----ITS2

ATCGCGTCGCCCCCCTCCCGCGCGCACGGCGCCGGCGAGGGGGGCGGAGATTGGCCTCCCGTGCGCCCCGGCGCGCGGCCGGCCCAAATGCGATCCCCCGACGGCGCACGTCGCGACCAGTGGTGGTTGAACACGAACGTCAACTCTCGTGCTGTCGCGGCCCGTCCGCTCGGGGAGATCACCGCATCGACCCAAACGGCGCTCCGGCGCCTCCGA
Taxonomic Information

Plant ID: NPO18640
Plant Latin Name: Tectona Grandis
Taxonomy Genus: Tectona
Taxonomy Family: Lamiaceae

Plant External Links:

NCBI TaxonomyDB: 41396
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Ghana; Philippines; Indonesia; India; Togo; China; Thailand

Traditional Medicine System:
Sowa-Rigpa; Indian Folk; Unani; Siddha; Ayurveda; TCM

Geographical Distribution

Ghana; Philippines; Indonesia; India; Togo; China; Thailand

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

108 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


100 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

11 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98340

Ingredient ID: NPC97965

Ingredient ID: NPC97632

Ingredient ID: NPC97455

Ingredient ID: NPC92573

Ingredient ID: NPC89102

Ingredient ID: NPC88150

Ingredient ID: NPC86541

Ingredient ID: NPC7934

Ingredient ID: NPC77338

Ingredient ID: NPC74923

Ingredient ID: NPC70622

Ingredient ID: NPC63632

Ingredient ID: NPC61076

Ingredient ID: NPC51743

Ingredient ID: NPC46072

Ingredient ID: NPC46056

Ingredient ID: NPC37818

Ingredient ID: NPC3224

Ingredient ID: NPC312592

Ingredient ID: NPC310491

Ingredient ID: NPC309778

Ingredient ID: NPC306418

Ingredient ID: NPC303693

Ingredient ID: NPC302416

Ingredient ID: NPC301632

Ingredient ID: NPC300561

Ingredient ID: NPC299401

Ingredient ID: NPC298215

Ingredient ID: NPC290864

Ingredient ID: NPC289883

Ingredient ID: NPC289032

Ingredient ID: NPC288656

Ingredient ID: NPC285391

Ingredient ID: NPC282923

Ingredient ID: NPC282635

Ingredient ID: NPC281220

Ingredient ID: NPC280381

Ingredient ID: NPC279870

Ingredient ID: NPC276673

Ingredient ID: NPC276516

Ingredient ID: NPC27460

Ingredient ID: NPC271450

Ingredient ID: NPC270348

Ingredient ID: NPC270028

Ingredient ID: NPC26960

Ingredient ID: NPC269036

Ingredient ID: NPC264249

Ingredient ID: NPC263662

Ingredient ID: NPC261962

Ingredient ID: NPC259459

Ingredient ID: NPC255488

Ingredient ID: NPC2514

Ingredient ID: NPC249910

Ingredient ID: NPC249012

Ingredient ID: NPC246172

Ingredient ID: NPC238520

Ingredient ID: NPC236224

Ingredient ID: NPC231774

Ingredient ID: NPC230747

Ingredient ID: NPC228401

Ingredient ID: NPC227750

Ingredient ID: NPC221778

Ingredient ID: NPC220053

Ingredient ID: NPC216692

Ingredient ID: NPC215835

Ingredient ID: NPC214907

Ingredient ID: NPC212442

Ingredient ID: NPC212415

Ingredient ID: NPC20550

Ingredient ID: NPC200294

Ingredient ID: NPC198706

Ingredient ID: NPC196795

Ingredient ID: NPC196636

Ingredient ID: NPC192577

Ingredient ID: NPC191474

Ingredient ID: NPC190027

Ingredient ID: NPC180855

Ingredient ID: NPC174812

Ingredient ID: NPC171538

Ingredient ID: NPC165973

Ingredient ID: NPC164935

Ingredient ID: NPC160525

Ingredient ID: NPC157778

Ingredient ID: NPC156433

Ingredient ID: NPC15447

Ingredient ID: NPC149115

Ingredient ID: NPC145294

Ingredient ID: NPC143591

Ingredient ID: NPC142752

Ingredient ID: NPC137797

Ingredient ID: NPC131592

Ingredient ID: NPC131489

Ingredient ID: NPC128425

Ingredient ID: NPC128174

Ingredient ID: NPC126368

Ingredient ID: NPC125359

Ingredient ID: NPC12421

Ingredient ID: NPC123034

Ingredient ID: NPC122121

Ingredient ID: NPC108348

Ingredient ID: NPC107325

Ingredient ID: NPC105591

Ingredient ID: NPC105539

Ingredient ID: NPC102889

Ingredient ID: NPC101733

Ingredient ID: NPC100395

Ingredient ID: NPC100037