CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Neurolaena Lobata

Example Image

PLANiTS DNA barcode

Click for details-----ITS

TACTGCATAGCAGAACCACCCGTGAATGAGTACCTGTAACATTGTGTTATGGGGACTGATGCTTTAGTTTCATGCCTCTTAATGCTTTGCCGACTTGTGTTCATGTTTTCCTTGCTAGGGCCTCTTGAACATTAAGTTGACACATTAACACCCCCCCGGCACGGCACGTGCCAAGGAAATGCTAACTAAAAGGGCCTGTGTCACTTCACCCCGTTTACGGTGTGTGTAAAGCATGAAGCCTTTTTGTAAACTGAACGACTCTCGGCAACGGATATCTCGGCTCATGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTTGGTTGAGGGCACGCCTGCTTGGGTGTCACGCATCACATCGCCTCCATCAAATATCTCTGCATGGGATGTATTGGATGGGGCGGAAATTGGTCTCCTATGCTTCTGACATGGTTGGCCTAAATAGGAGTTGCCTTGAAAAGGAACACACAACTAGTGGTGGTTGAAAAAACAGTCGTCTCATGTTGTGTGTTTTGATTTTGGGAGGAGAAGCTCTTATAATACCCTTAGCGTTGTCTTTTGATGGTGCTTTGA

Click for details-----ITS1

Click for details-----ITS2

ATCACATCGCCTCCATCAAATATCTCTGCATGGGATGTATTGGATGGGGCGGAAATTGGTCTCCTATGCTTCTGACATGGTTGGCCTAAATAGGAGTTGCCTTGAAAAGGAACACACAACTAGTGGTGGTTGAAAAAACAGTCGTCTCATGTTGTGTGTTTTGATTTTGGGAGGAGAAGCTCTTATAATACCCTTAGCGTTGTCTTTTGATGGTGCTTTGA

Taxonomic Information

Plant ID: NPO18618
Plant Latin Name: Neurolaena Lobata
Taxonomy Genus: Neurolaena
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: 183056
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:

Mexico

Traditional Medicine System:

Geographical Distribution

Mexico

Geographical Distribution

−

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

99 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

24 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

43 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC98200

Ingredient ID: NPC9592

Ingredient ID: NPC92212

Ingredient ID: NPC91204

Ingredient ID: NPC88773

Ingredient ID: NPC86785

Ingredient ID: NPC86678

Ingredient ID: NPC86078

Ingredient ID: NPC76453

Ingredient ID: NPC73464

Ingredient ID: NPC69952

Ingredient ID: NPC68352

Ingredient ID: NPC65238

Ingredient ID: NPC64092

Ingredient ID: NPC60087

Ingredient ID: NPC49651

Ingredient ID: NPC49315

Ingredient ID: NPC48781

Ingredient ID: NPC484207

Ingredient ID: NPC484206

Ingredient ID: NPC484205

Ingredient ID: NPC484204

Ingredient ID: NPC484203

Ingredient ID: NPC480387

Ingredient ID: NPC47880

Ingredient ID: NPC46663

Ingredient ID: NPC45539

Ingredient ID: NPC45112

Ingredient ID: NPC39430

Ingredient ID: NPC38154

Ingredient ID: NPC329254

Ingredient ID: NPC328929

Ingredient ID: NPC328716

Ingredient ID: NPC32739

Ingredient ID: NPC32715

Ingredient ID: NPC307281

Ingredient ID: NPC306804

Ingredient ID: NPC30390

Ingredient ID: NPC295409

Ingredient ID: NPC291440

Ingredient ID: NPC288208

Ingredient ID: NPC283924

Ingredient ID: NPC277091

Ingredient ID: NPC274836

Ingredient ID: NPC273801

Ingredient ID: NPC271958

Ingredient ID: NPC269383

Ingredient ID: NPC266149

Ingredient ID: NPC264042

Ingredient ID: NPC263507

Ingredient ID: NPC2603

Ingredient ID: NPC258637

Ingredient ID: NPC25464

Ingredient ID: NPC246889

Ingredient ID: NPC244509

Ingredient ID: NPC244336

Ingredient ID: NPC23804

Ingredient ID: NPC237517

Ingredient ID: NPC233924

Ingredient ID: NPC227908

Ingredient ID: NPC227778

Ingredient ID: NPC226130

Ingredient ID: NPC224925

Ingredient ID: NPC219424

Ingredient ID: NPC218754

Ingredient ID: NPC217981

Ingredient ID: NPC217957

Ingredient ID: NPC214723

Ingredient ID: NPC212699

Ingredient ID: NPC207675

Ingredient ID: NPC19822

Ingredient ID: NPC19661

Ingredient ID: NPC193019

Ingredient ID: NPC189454

Ingredient ID: NPC188942

Ingredient ID: NPC188703

Ingredient ID: NPC178292

Ingredient ID: NPC177849

Ingredient ID: NPC174729

Ingredient ID: NPC163176

Ingredient ID: NPC156380

Ingredient ID: NPC153904

Ingredient ID: NPC151030

Ingredient ID: NPC150484

Ingredient ID: NPC149925

Ingredient ID: NPC148634

Ingredient ID: NPC139774

Ingredient ID: NPC137791

Ingredient ID: NPC134413

Ingredient ID: NPC132771

Ingredient ID: NPC129717

Ingredient ID: NPC122175

Ingredient ID: NPC111723

Ingredient ID: NPC110129

Ingredient ID: NPC108679

Ingredient ID: NPC10829

Ingredient ID: NPC108228

Ingredient ID: NPC107225

Ingredient ID: NPC105107

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Show entries

Search:

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Nuclear hormone receptor subfamily 3	ESR1	Estrogen receptor alpha	P03372	CHEMBL206
Therapeutic Target	Nuclear hormone receptor subfamily 3	ESR2	Estrogen receptor beta	Q92731	CHEMBL242

Showing 1 to 2 of 2 entries

Previous1Next

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials

Clinical trial details

Show entries

Search:

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
No data available in table

Showing 0 to 0 of 0 entries

PreviousNext

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Show entries

Search:

Associated Disease of the Plant	Association Type & Detailed Evidence
Acidosis Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C73	CACNA1H
Acne vulgaris Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED80	ESR1
Acquired prion disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8E01	ESR1
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	CACNA1G,CACNA1H
Adrenal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	ESR1
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	ESR2
Brain cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00	CACNA1H,ESR1
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	ESR1,ESR2
Breast in situ carcinoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2E65	ESR1
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	CACNA1G

Showing 1 to 10 of 59 entries

Previous1 2 3 4 5 6Next

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Neurolaena Lobata

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

Country/Region:

Traditional Medicine System:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

99 All known Ingredients in Total

24 Ingredients with Acceptable Bioavailablity

43 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Acidosis

Acne vulgaris

Acquired prion disease

Adenocarcinoma of pancreas

Adrenal cancer

Alzheimer disease

Brain cancer

Breast cancer

Breast in situ carcinoma

Carcinosarcoma of uterus

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

>> Targets derived from weak experimental activities