CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Cryptocarya Triplinervis

Example Image

PLANiTS DNA barcode

TCGTGGAAAAGAACCAACATGCGAACCCGTTCAGTCACTCTTCGCACGCGGCCGCGCCCTCCGTCCTCGCTCTTCCGCACGGTCGTTGGCGGGGGTCGAGGGCGCGCGACCGGCCGAGCGACAACAACAGGGCGCATCGCGCGCCAAGCACTTGAAGCGAAAAGGTTGGGCCCCTCGCCCGTTGCTTCGCCCCTTCCAGTCAGTCGGGGCACGGCATCGACGCGGGGGACCCTTCCGAACGACTCCGATCGAAGA

Click for details-----ITS2

CCCCGATCGCTCCCCCGCGGCATGGCCTGCCCCGGGGAGGCGGAGACTGGCTGCCCGTGCGCCACTCGAGGGCGAGCGGTTGGCCCAAATGCAGGTCAAAGTGCGGTGCGGCGCGACGCGTGGTGGTTTGGAGCCGCGATCGATCGCGAATCGGACGCAGTGCCTGCGTCACGCCGCACCCGTGCGACACGTGGGACGCAGCTTGCCTGTTACGGCGGGCTCTCGGA

Taxonomic Information

Plant ID: NPO18465
Plant Latin Name: Cryptocarya Triplinervis
Taxonomy Genus: Cryptocarya
Taxonomy Family: Lauraceae

Plant External Links:

NCBI TaxonomyDB: 136115
Plant-of-the-World-Online: 464161-1

Used in Medicines

Unknown.

Geographical Distribution

Australia; Indonesia

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

22 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

20 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)