CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Aristolochia Manshuriensis

Example Image

PLANiTS DNA barcode

CCCCCCAACTCTCCTCCCCCGACCCCCTCGCGCGACCCCTCCGATCGGAGGGTGCGTGGGGGGTGTCCCGTGGTGCGAGCAGACTGGCCGCCCGTGCCTCTCGGGTGCGGTTGGCTGAAAGCCTGGCCCGACGGCGGCGTGCGGCACGACAAGTGGTGGCTCGGCCCTCCCAGGCCATGAGTGTCTCGATGTCGTGTTTGCGGATTCGCCGCTCGAGGCCGCTGAGGACCCTAACCGTTCGCCTCCACTCCAGGAGGCGTCGCTCGGA

Taxonomic Information

Plant ID: NPO18443
Plant Latin Name: Aristolochia Manshuriensis
Taxonomy Genus: Aristolochia
Taxonomy Family: Aristolochiaceae

Plant External Links:

NCBI TaxonomyDB: 158555
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:

China

Traditional Medicine System:

TCM

Geographical Distribution

China

Geographical Distribution

−

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

44 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

36 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

27 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC85661

Ingredient ID: NPC81010

Ingredient ID: NPC77359

Ingredient ID: NPC74646

Ingredient ID: NPC70744

Ingredient ID: NPC69213

Ingredient ID: NPC68154

Ingredient ID: NPC57705

Ingredient ID: NPC51986

Ingredient ID: NPC470082

Ingredient ID: NPC44755

Ingredient ID: NPC38961

Ingredient ID: NPC328788

Ingredient ID: NPC305944

Ingredient ID: NPC29883

Ingredient ID: NPC296742

Ingredient ID: NPC293040

Ingredient ID: NPC28425

Ingredient ID: NPC28198

Ingredient ID: NPC270768

Ingredient ID: NPC263817

Ingredient ID: NPC261836

Ingredient ID: NPC258019

Ingredient ID: NPC24101

Ingredient ID: NPC240684

Ingredient ID: NPC224719

Ingredient ID: NPC214869

Ingredient ID: NPC206052

Ingredient ID: NPC196776

Ingredient ID: NPC195749

Ingredient ID: NPC192977

Ingredient ID: NPC191629

Ingredient ID: NPC171882

Ingredient ID: NPC171495

Ingredient ID: NPC16436

Ingredient ID: NPC159418

Ingredient ID: NPC159101

Ingredient ID: NPC146192

Ingredient ID: NPC142415

Ingredient ID: NPC125713

Ingredient ID: NPC12053

Ingredient ID: NPC119579

Ingredient ID: NPC118332

Ingredient ID: NPC112866

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Show entries

Search:

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Drug Transporter	SLC superfamily of solute carriers	SLCO1B3	Solute carrier organic anion transporter family member 1B3	Q9NPD5	CHEMBL1743121
Therapeutic Target	Enzyme	CES1	Acyl coenzyme A:cholesterol acyltransferase	P23141	CHEMBL2265
Therapeutic Target	Lyase	CA2	Carbonic anhydrase II	P00918	CHEMBL205
Therapeutic Target	Nuclear hormone receptor subfamily 1	NR1H4	Bile acid receptor FXR	Q96RI1	CHEMBL2047
Therapeutic Target	Protein Kinase	CDK2	Cyclin-dependent kinase 2	P24941	CHEMBL301
Therapeutic Target	Protein Kinase	CDK1	Cyclin-dependent kinase 1	P06493	CHEMBL308
Therapeutic Target	Protein Phosphatase	CDC25B	Dual specificity phosphatase Cdc25B	P30305	CHEMBL4804
Therapeutic Target	Small molecule receptor (family A GPCR)	DRD1	Dopamine D1 receptor	P21728	CHEMBL2056
Therapeutic Target	Surface antigen	F3	Coagulation factor III	P13726	CHEMBL4081
Therapeutic Target	Unclassified protein	SNCA	Alpha-synuclein	P37840	CHEMBL6152

Showing 1 to 10 of 10 entries

Previous1Next

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials

Clinical trial details

Show entries

Search:

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
No data available in table

Showing 0 to 0 of 0 entries

PreviousNext

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Show entries

Search:

Associated Disease of the Plant	Association Type & Detailed Evidence
Abortion Disease Category: 18.Pregnancy, childbirth or the puerperium Disease ICD-11 Code: JA00	DRD1
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	PTPN1,AKR1B1
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	PTPRC
Acute respiratory distress syndrome Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB00	F3
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	AKR1B10,SLCO1B3,CDK1
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	PTPN1,CES1,AKR1B10,SLCO1B3,SNCA,CA2,DRD1,CDC25B,PTPRC
Adenocarcinoma of prostate Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82.0	SLCO1B3
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	CDK1,SLCO1B3,DRD1,CDC25B
Allergic/hypersensitivity disorder Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A80-4A8Z	DRD1
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	SNCA

Showing 1 to 10 of 94 entries

Previous1 2 3 4 5…10Next

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Aristolochia Manshuriensis

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

Country/Region:

Traditional Medicine System:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

44 All known Ingredients in Total

36 Ingredients with Acceptable Bioavailablity

27 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Abortion

Acute diabete complication

Acute myeloid leukaemia

Acute respiratory distress syndrome

Adenocarcinoma of bronchus or lung

Adenocarcinoma of pancreas

Adenocarcinoma of prostate

Adenocarcinoma of stomach

Allergic/hypersensitivity disorder

Alzheimer disease

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

>> Targets derived from weak experimental activities