• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Eucalyptus Ovata


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

AACGACCAGAGAACCGGTAACAAACTCAACGGGGACGGCGGGCTCAGCCCGACGTCCCTATCGACGCCGGGGATCGGGGTCGRGCTCCTCAGGGCGCTCGGTCCTCGTCCTCGGCGGCGCAACGAACCCCGGCGCGGAATGCGCCAAGGAACTYGAACARGAGTGCGATGCTCCCGCCGCCCCATACACGGTGCGCGCGCGGGACGCCATGCAATCTCATATTACTCATAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO18413
Plant Latin Name: Eucalyptus Ovata
Taxonomy Genus: Eucalyptus
Taxonomy Family: Myrtaceae

Plant External Links:

NCBI TaxonomyDB: 155760
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

29 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


4 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

10 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC58950

Ingredient ID: NPC51707

Ingredient ID: NPC43094

Ingredient ID: NPC41844

Ingredient ID: NPC313179

Ingredient ID: NPC311830

Ingredient ID: NPC283199

Ingredient ID: NPC267022

Ingredient ID: NPC260221

Ingredient ID: NPC258334

Ingredient ID: NPC242057

Ingredient ID: NPC222884

Ingredient ID: NPC222268

Ingredient ID: NPC214496

Ingredient ID: NPC210073

Ingredient ID: NPC198722

Ingredient ID: NPC194663

Ingredient ID: NPC18188

Ingredient ID: NPC171736

Ingredient ID: NPC167634

Ingredient ID: NPC159340

Ingredient ID: NPC158034

Ingredient ID: NPC149545

Ingredient ID: NPC149184

Ingredient ID: NPC143014

Ingredient ID: NPC119987

Ingredient ID: NPC115959

Ingredient ID: NPC105115

Ingredient ID: NPC10171