• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Rheum Wittrocki


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCGCAAGCAGACAGACCCGCGAACCCGTCTTTAACCCGCCGTCGGGGGGGGATCGGGCTCTCTTTTGAGTCCCCCCCTCCCGGCGCGCGCCAACCAAACCCCGGCGCGGATTGCGCCAAGGACTATGAACAAGAGCGCGTCCCGCGCGCCCCGGCGCGCGTGCGACGTCGCGTCGTTTCTACTTAACAGAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAAGCCTTCTGGCCGAGGGCACGTCTGTCTGGGCGTCACGCACCGCGTCGCCCCCGCCCCCCTCCGGGGGTCCGGGGCGGAGATTGGCCTCCCGTGCGCCCCGGCGCGCGGCCGGCCTAAACGCAAGCCCCGCGGCCGCGAGAATCCGCGACGATTGGTGGTGTACCAGCGGCCCAGTGCCGCGAAGCATCGCGTCGCGTCTCGCGCGGCTGTCGTAAGTGCCAAAGGGCCCCGACCACCGTTGCG

Click for details-----ITS1

TCGAAACCTGCGCAAGCAGACAGACCCGCGAACCCGTCTTTAACCCGCCGTCGGGGGGGGATCGGGCTCTCTTTTGAGTCCCCCCCTCCCGGCGCGCGCCAACCAAACCCCGGCGCGGATTGCGCCAAGGACTATGAACAAGAGCGCGTCCCGCGCGCCCCGGCGCGCGTGCGACGTCGCGTCGTTTCTACTTAACAGAA

Click for details-----ITS2

ACCGCGTCGCCCCCGCCCCCCTCCGGGGGTCCGGGGCGGAGATTGGCCTCCCGTGCGCCCCGGCGCGCGGCCGGCCTAAACGCAAGCCCCGCGGCCGCGAGAATCCGCGACGATTGGTGGTGTACCAGCGGCCCAGTGCCGCGAAGCATCGCGTCGCGTCTCGCGCGGCTGTCGTAAGTGCCAAAGGGCCCCGACCACCGTTGCG
Taxonomic Information

Plant ID: NPO18339
Plant Latin Name: Rheum Wittrocki
Taxonomy Genus: Rheum
Taxonomy Family: Polygonaceae

Plant External Links:

NCBI TaxonomyDB: n.a.
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM

Geographical Distribution

China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

16 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


11 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

12 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC34864

Ingredient ID: NPC3224

Ingredient ID: NPC30432

Ingredient ID: NPC301164

Ingredient ID: NPC282923

Ingredient ID: NPC278329

Ingredient ID: NPC267205

Ingredient ID: NPC254848

Ingredient ID: NPC254847

Ingredient ID: NPC248573

Ingredient ID: NPC242712

Ingredient ID: NPC234689

Ingredient ID: NPC171156

Ingredient ID: NPC161571

Ingredient ID: NPC115022

Ingredient ID: NPC105591