• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Medicago Sativa


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGATGCCTTACATGCAGTCCAACACGTGAATCAGTTTGAATACATATGGTTGGCTTGAGGTGTTCTACACCTCGGCTTACCTCTTGGTTCAGAGGAAGACGACGAAGTGCGTCCTCCTTTGTGCCAAAACTCAAACCCCGGCGCTGAATGCGTCAAGGAATTTAAATTTTGCTCTGAGCACACCTGCATGGCACCGGAGACGGTTTTCGTGCGTGTTGTGTTTTGACACATGATATAGAATGACTCTCGGCAACGGATATCTAGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGATGCCATTAGGTTGAGGGCACGTCTGCCTGGGTGTCACATATCGTCGCCCCCGTCAAACCCCGAGCCCTCGGGCCGGGATCGACGCGCGGGCGGAAATTGGCCTCCCGTGCGCTCACCGCTCGCGGTTGGTCTAAATTCGAGTCCTCGGCGATGAAGCGCCGCGACGATCGGTGGGAACGCCTTCGGCTGCCTCGTTCGGAGTCGCGCGCGCTCGTCGATCGGGACGCTTTCGACCCTTTAAGGCATCGCGACGTCGATGCTCGCATCG

Click for details-----ITS1

TCGATGCCTTACATGCAGTCCAACACGTGAATCAGTTTGAATACATATGGTTGGCTTGAGGTGTTCTACACCTCGGCTTACCTCTGGTTCAGAGGAAGACGACATAGTGCGTCCTCCTTCGTGCCAAAACTCAAACCCCGGCGCTGAATGCGTCAAGGAATTTAAATTTTGCTCTGAGCACACCTGCATGGCACCGGAGACGGTTTTCGTGCGTGTTGTGTTTTGACACATGATATAGAA

Click for details-----ITS2

ATCGAATCCCCTTGCCAATTTCCTATTTATTAGGTATTGCGTGCAGGGTGAATATGTTGGCCTCCCGTGAGCTCTGTCTCGTGGTTGGTTGAAAATTGAGACCTTGGTAGGGTGTGCCATGATAGATGGTGGATGTGTGACCCACGAGACCCAAATTCATGTGCAGCTCTATTGAACGTGGACTCTTTTACCCACATGTGTTTTATAACGCTCGTGATGA
Taxonomic Information

Plant ID: NPO18321
Plant Latin Name: Medicago Sativa
Taxonomy Genus: Medicago
Taxonomy Family: Fabaceae

Plant External Links:

NCBI TaxonomyDB: 3879
Plant-of-the-World-Online: 30234961-2

Used in Medicines

Country/Region:
China; Argentina; India; Turkmenistan; Chile

Traditional Medicine System:
Unani; TCM; Homeopathy; Ayurveda


Medicinal Functions:

Anodyne; Antibacterial; Antiscorbutic; Aperient; Diuretic; Emetic; Febrifuge; Haemostatic; Hypoglycaemic; Nutritive; Stimulant; Tonic

Geographical Distribution

Brazil; Afghanistan; Italy; Bangladesh; Sudan; Nepal; Mongolia; France; Somalia; Ireland; Argentina; Bolivia; Norway; Ecuador; Turkmenistan; Uzbekistan; Saudi Arabia; Australia; Iran; Algeria; Cuba; Turkey; Venezuela; Austria; Russia; United States; Guatemala; China; Chile; Oman; Belgium; Germany; Dominican Republic; Iraq; Kazakhstan; Spain; Ukraine; Netherlands; Libya; Denmark; Poland; Finland; New Caledonia; Mauritius; Morocco; Sweden; Belarus; Switzerland; Uruguay; New Zealand; Yemen; Haiti; Bulgaria; Pakistan; Romania; Albania; Angola; Portugal; Chad; Mexico; Egypt; Tajikistan; South Africa; India; Peru; United Kingdom; Tunisia; Djibouti; Colombia; Greece; Sri Lanka; Hungary; Cyprus

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

91 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


60 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

47 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98555

Ingredient ID: NPC98304

Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC85813

Ingredient ID: NPC84226

Ingredient ID: NPC76145

Ingredient ID: NPC73143

Ingredient ID: NPC71371

Ingredient ID: NPC68889

Ingredient ID: NPC63318

Ingredient ID: NPC62045

Ingredient ID: NPC59650

Ingredient ID: NPC56198

Ingredient ID: NPC55412

Ingredient ID: NPC53028

Ingredient ID: NPC490427

Ingredient ID: NPC490424

Ingredient ID: NPC489907

Ingredient ID: NPC424

Ingredient ID: NPC41326

Ingredient ID: NPC39426

Ingredient ID: NPC36882

Ingredient ID: NPC34764

Ingredient ID: NPC328447

Ingredient ID: NPC322339

Ingredient ID: NPC320323

Ingredient ID: NPC318724

Ingredient ID: NPC318696

Ingredient ID: NPC315672

Ingredient ID: NPC312713

Ingredient ID: NPC305741

Ingredient ID: NPC299781

Ingredient ID: NPC295697

Ingredient ID: NPC294548

Ingredient ID: NPC293714

Ingredient ID: NPC291428

Ingredient ID: NPC288241

Ingredient ID: NPC279865

Ingredient ID: NPC279661

Ingredient ID: NPC278363

Ingredient ID: NPC269919

Ingredient ID: NPC2660

Ingredient ID: NPC258957

Ingredient ID: NPC257885

Ingredient ID: NPC242580

Ingredient ID: NPC24219

Ingredient ID: NPC240336

Ingredient ID: NPC236709

Ingredient ID: NPC236340

Ingredient ID: NPC234560

Ingredient ID: NPC234106

Ingredient ID: NPC230085

Ingredient ID: NPC229113

Ingredient ID: NPC226690

Ingredient ID: NPC21547

Ingredient ID: NPC209560

Ingredient ID: NPC208448

Ingredient ID: NPC20791

Ingredient ID: NPC206924

Ingredient ID: NPC206500

Ingredient ID: NPC201284

Ingredient ID: NPC200015

Ingredient ID: NPC192040

Ingredient ID: NPC18950

Ingredient ID: NPC189436

Ingredient ID: NPC187770

Ingredient ID: NPC183845

Ingredient ID: NPC181574

Ingredient ID: NPC180871

Ingredient ID: NPC180781

Ingredient ID: NPC17810

Ingredient ID: NPC174246

Ingredient ID: NPC1682

Ingredient ID: NPC167400

Ingredient ID: NPC16087

Ingredient ID: NPC159630

Ingredient ID: NPC158756

Ingredient ID: NPC157857

Ingredient ID: NPC150950

Ingredient ID: NPC147983

Ingredient ID: NPC142597

Ingredient ID: NPC1397

Ingredient ID: NPC138113

Ingredient ID: NPC136014

Ingredient ID: NPC130683

Ingredient ID: NPC127624

Ingredient ID: NPC125935

Ingredient ID: NPC120635

Ingredient ID: NPC119724

Ingredient ID: NPC112890