• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Carthamus Tinctorius


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAGCCTGCACAGCAGAACGACCCGTGAACATGTAATCACAACCGGGTGTCGTGGGATTGGGTGTGAGCCTTAGCCCTACGATGCTTGTCGGCATGCGTGCAAGGTGCTTATCTCTAGGCATCGTGGACGTCGTGTCGGCACAAAAACAAACCCCGGCACGGCATGTGCCAAGGAAAACAAAACTTAAGAAGGGTTCGTCTCGTGTTGCCCCGTTTGCGGTGTGCACACGGGTCGTGGCCTCTCATTAACCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCCTGCCTGGGCGTCACGCATCGCGTCGCCCCAGACCATGCTCCCCCATGGGGGAAGATGGTTTTGGTTTGGGAACGAAGAGTGGTCTCCCCGTGTCGATTGGTGCGGTTGGCCTTAAAAAGGAGTCCCCTTTGGCGGACGCACGGCTTAGTGGTGGTTGTAAAGGACTTCGTAACGAGCCGTGTTGATGCTAGGGAATTGCTCTCTAAAGACCCTAACGTGTCGTCTTACGACGATGCTTCGACC

Click for details-----ITS1

NA

Click for details-----ITS2

ATCGCGTCGCCCCAGACCATGCTCCCCCATGGGGGAAGATGGTTTTGGTTTGGGAACGAAGAGTGGTCTCCCCGTGTCGATTGGTGCGGTTGGCCTTAAAAAGGAGTCCCCTTTGGCGGACGCACGGCTTAGTGGTGGTTGTAAAGGACTTCGTAACGAGCCGTGTTGATGCTAGGGAATTGCTCTCTAAAGACCCTAACGTGTCGTCTTACGACGATGCTTCGACC
Taxonomic Information

Plant ID: NPO18311
Plant Latin Name: Carthamus Tinctorius
Taxonomy Genus: Carthamus
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: 4222
Plant-of-the-World-Online: 324467-2

Used in Medicines

Country/Region:
Philippines; Indonesia; India; China; Jordan; Thailand; South Korea

Traditional Medicine System:
Sowa-Rigpa; Indian Folk; Unani; Siddha; Ayurveda; Kampo; TCM

Geographical Distribution

Canada; Afghanistan; Italy; Bangladesh; Kuwait; Cambodia; Ethiopia; Ireland; Laos; Argentina; Thailand; Saudi Arabia; Australia; Iran; Algeria; Turkey; Jordan; Chile; China; Poland; Spain; Ukraine; Eritrea; Netherlands; Libya; Oman; Philippines; Indonesia; United States; Morocco; Uruguay; Hungary; New Zealand; Yemen; Russia; Romania; Myanmar; Mexico; Egypt; South Africa; India; United Kingdom; Tunisia; Austria; Vietnam; Paraguay; Japan; South Korea

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

236 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


158 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

136 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC9788

Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC93201

Ingredient ID: NPC88966

Ingredient ID: NPC88839

Ingredient ID: NPC88566

Ingredient ID: NPC88072

Ingredient ID: NPC85813

Ingredient ID: NPC82550

Ingredient ID: NPC81989

Ingredient ID: NPC81010

Ingredient ID: NPC79456

Ingredient ID: NPC79316

Ingredient ID: NPC78500

Ingredient ID: NPC77575

Ingredient ID: NPC77225

Ingredient ID: NPC76817

Ingredient ID: NPC72030

Ingredient ID: NPC7106

Ingredient ID: NPC70744

Ingredient ID: NPC6984

Ingredient ID: NPC68779

Ingredient ID: NPC67463

Ingredient ID: NPC65873

Ingredient ID: NPC64342

Ingredient ID: NPC62045

Ingredient ID: NPC61198

Ingredient ID: NPC61066

Ingredient ID: NPC6095

Ingredient ID: NPC60408

Ingredient ID: NPC59581

Ingredient ID: NPC58957

Ingredient ID: NPC58813

Ingredient ID: NPC560

Ingredient ID: NPC55586

Ingredient ID: NPC55412

Ingredient ID: NPC54383

Ingredient ID: NPC52403

Ingredient ID: NPC51627

Ingredient ID: NPC49151

Ingredient ID: NPC49074

Ingredient ID: NPC490021

Ingredient ID: NPC489907

Ingredient ID: NPC48623

Ingredient ID: NPC481003

Ingredient ID: NPC481002

Ingredient ID: NPC43246

Ingredient ID: NPC42419

Ingredient ID: NPC424

Ingredient ID: NPC42372

Ingredient ID: NPC38132

Ingredient ID: NPC3672

Ingredient ID: NPC36482

Ingredient ID: NPC36061

Ingredient ID: NPC35565

Ingredient ID: NPC34764

Ingredient ID: NPC34589

Ingredient ID: NPC32977

Ingredient ID: NPC328447

Ingredient ID: NPC327838

Ingredient ID: NPC327500

Ingredient ID: NPC323434

Ingredient ID: NPC317120

Ingredient ID: NPC316679

Ingredient ID: NPC312132

Ingredient ID: NPC311663

Ingredient ID: NPC310775

Ingredient ID: NPC30853

Ingredient ID: NPC308469

Ingredient ID: NPC30760

Ingredient ID: NPC30563

Ingredient ID: NPC30433

Ingredient ID: NPC304208

Ingredient ID: NPC301585

Ingredient ID: NPC299131

Ingredient ID: NPC29883

Ingredient ID: NPC295777

Ingredient ID: NPC294902

Ingredient ID: NPC294548

Ingredient ID: NPC293488

Ingredient ID: NPC292869

Ingredient ID: NPC290613

Ingredient ID: NPC290319

Ingredient ID: NPC29

Ingredient ID: NPC287895

Ingredient ID: NPC286915

Ingredient ID: NPC286774

Ingredient ID: NPC286627

Ingredient ID: NPC284120

Ingredient ID: NPC283584

Ingredient ID: NPC281686

Ingredient ID: NPC279300

Ingredient ID: NPC279026

Ingredient ID: NPC278231

Ingredient ID: NPC277570

Ingredient ID: NPC27699

Ingredient ID: NPC275462

Ingredient ID: NPC273385

Ingredient ID: NPC272614

Ingredient ID: NPC270796

Ingredient ID: NPC269919

Ingredient ID: NPC26974

Ingredient ID: NPC268557

Ingredient ID: NPC267074

Ingredient ID: NPC266144

Ingredient ID: NPC265885

Ingredient ID: NPC262505

Ingredient ID: NPC261831

Ingredient ID: NPC260951

Ingredient ID: NPC254156

Ingredient ID: NPC250855

Ingredient ID: NPC250734

Ingredient ID: NPC250539

Ingredient ID: NPC250437

Ingredient ID: NPC249815

Ingredient ID: NPC249045

Ingredient ID: NPC246094

Ingredient ID: NPC243728

Ingredient ID: NPC243702

Ingredient ID: NPC242580

Ingredient ID: NPC242260

Ingredient ID: NPC237812

Ingredient ID: NPC23508

Ingredient ID: NPC232554

Ingredient ID: NPC230301

Ingredient ID: NPC228366

Ingredient ID: NPC226453

Ingredient ID: NPC225710

Ingredient ID: NPC225563

Ingredient ID: NPC223455

Ingredient ID: NPC223084

Ingredient ID: NPC221604

Ingredient ID: NPC219913

Ingredient ID: NPC218610

Ingredient ID: NPC218109

Ingredient ID: NPC21806

Ingredient ID: NPC216630

Ingredient ID: NPC209971

Ingredient ID: NPC209970

Ingredient ID: NPC208793

Ingredient ID: NPC208620

Ingredient ID: NPC208553

Ingredient ID: NPC208075

Ingredient ID: NPC20791

Ingredient ID: NPC203468

Ingredient ID: NPC202189

Ingredient ID: NPC201844

Ingredient ID: NPC199379

Ingredient ID: NPC197356

Ingredient ID: NPC196924

Ingredient ID: NPC195351

Ingredient ID: NPC19527

Ingredient ID: NPC195000

Ingredient ID: NPC1912

Ingredient ID: NPC190052

Ingredient ID: NPC189853

Ingredient ID: NPC186653

Ingredient ID: NPC186098

Ingredient ID: NPC185755

Ingredient ID: NPC185558

Ingredient ID: NPC184130

Ingredient ID: NPC18335

Ingredient ID: NPC182841

Ingredient ID: NPC181465

Ingredient ID: NPC181153

Ingredient ID: NPC179950

Ingredient ID: NPC179103

Ingredient ID: NPC179092

Ingredient ID: NPC178784

Ingredient ID: NPC178558

Ingredient ID: NPC177112

Ingredient ID: NPC176740

Ingredient ID: NPC175987

Ingredient ID: NPC175287

Ingredient ID: NPC174246

Ingredient ID: NPC173582

Ingredient ID: NPC171736

Ingredient ID: NPC17027

Ingredient ID: NPC169468

Ingredient ID: NPC1682

Ingredient ID: NPC167400

Ingredient ID: NPC165386

Ingredient ID: NPC164700

Ingredient ID: NPC164646

Ingredient ID: NPC163105

Ingredient ID: NPC161108

Ingredient ID: NPC160

Ingredient ID: NPC159907

Ingredient ID: NPC158908

Ingredient ID: NPC157100

Ingredient ID: NPC156461

Ingredient ID: NPC154186

Ingredient ID: NPC152451

Ingredient ID: NPC151949

Ingredient ID: NPC151620

Ingredient ID: NPC150950

Ingredient ID: NPC149975

Ingredient ID: NPC149905

Ingredient ID: NPC149184

Ingredient ID: NPC147983

Ingredient ID: NPC147062

Ingredient ID: NPC146197

Ingredient ID: NPC145952

Ingredient ID: NPC139029

Ingredient ID: NPC137958

Ingredient ID: NPC137949

Ingredient ID: NPC137309

Ingredient ID: NPC136996

Ingredient ID: NPC136014

Ingredient ID: NPC135353

Ingredient ID: NPC133671

Ingredient ID: NPC132087

Ingredient ID: NPC1308

Ingredient ID: NPC126681

Ingredient ID: NPC120926

Ingredient ID: NPC119949

Ingredient ID: NPC118244

Ingredient ID: NPC116775

Ingredient ID: NPC116013

Ingredient ID: NPC11433

Ingredient ID: NPC112890

Ingredient ID: NPC111888

Ingredient ID: NPC11150

Ingredient ID: NPC110789

Ingredient ID: NPC109034

Ingredient ID: NPC108779

Ingredient ID: NPC108691

Ingredient ID: NPC108598

Ingredient ID: NPC1075

Ingredient ID: NPC107482

Ingredient ID: NPC104195

Ingredient ID: NPC102536

Ingredient ID: NPC102449

Ingredient ID: NPC100980

Ingredient ID: NPC100570