• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Diospyros Kaki


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TTGTCGATTCCTGCAAAATGCAGAACAACCCGCGAACTAGTTCCTGCCATCATCCCGCAGCACGCGGGAAGGGCACGGGGCGTAGCTGCGGAGCGCGCTCGCGCGTGCCCCGACTCGCACGCCATCGAGCCCCCCCTAACGAACACCACGGCGCGAGTCGCGTCAAGGAATATGAAACTCGGAACGCGGATCCCCTGCCCCGAGTGCGGGAAGCAGGGGTCTTGCGAACTTCGAACTTACGAAACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCAGCCCCCCGCACCCAAAAAAAAAGGATCAAGCAAGCAATCCCTCGGCATGGAGCTTCTGCTTCGTCGTTGGCGTTGTGTTGGCCTTCTTTCTTGCTGGGGTCGGGGAGGCGACGTTGGCCTCCCGTGCGGGCAACCTCGCGGTTGGTCTAAATCTGAGTCCTCGGCGTCTGGCGGCGCGATCGACGGTGGTTTCCATGCCCTCGACGAATTGCGTCGCGCTCGCGAGACGCGCGGCGGAGAACTCCTCGCGGACCCTAATGCGTCGACTCGTCGGACGAGACACCGGCGAGAAGGCGCCATCGAAGCGACCCC

Click for details-----ITS1

CACACACAAAGTTGCAGCAAACCCCTTTGCGAATTTTATGATTGTCCCCCCCCCCTTTGGTGGGGGCTGGGGCACCAACAATCCTTATGGTTTTGTTTGTGTCCTGGCCTTTGCCAAAAGACCCTCCCAAGTTCCACCCGGGACTTGGGGGTACCCAACCGATTGCGCAATGCATCAACACTTTCAATATGACTGAGTAGCAAAAATTCGGGGCAACAACACTCTGCCTGCCTGCTTATGGCCATAAGTAGGGGTGCTTGCGTGCTTGCTTGCCCCCGAGTTGTAATAATAATAAAAA

Click for details-----ITS2

ATCGCAGCCCCCCGCACCCAAAAAAAAAGGATCAAGCAAGCAATCCCTCGGCATGGAGCTTCTGCTTCGTCGTTGGCGTTGTGTTGGCCTTCTTTCTTGCTGGGGTCGGGGAGGCGACGTTGGCCTCCCGTGCGGGCAACCTCGCGGTTGGTCTAAATCTGAGTCCTCGGCGTCTGGCGGCGCGATCGACGGTGGTTTCCATGCCCTCGACGAATTGCGTCGCGCTCGCGAGACGCGCGGCGGAGAACTCCTCGCGGACCCTAATGCGTCGACTCGTCGGACGAGACACCGGCGAGAAGGCGCCATCGAAGCGACCCC
Taxonomic Information

Plant ID: NPO18296
Plant Latin Name: Diospyros Kaki
Taxonomy Genus: Diospyros
Taxonomy Family: Ebenaceae

Plant External Links:

NCBI TaxonomyDB: 35925
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Italy; South Korea; India; Thailand

Traditional Medicine System:
Indian Folk


Medicinal Functions:

Anthelmintic; Antitussive; Antivinous; Appetizer; Astringent; Demulcent; Expectorant; Febrifuge; Hypotensive; Laxative; Sialagogue; Stomachic; Styptic

Geographical Distribution

Italy; South Korea; India; Thailand

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

117 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


66 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

39 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC95615

Ingredient ID: NPC9358

Ingredient ID: NPC88789

Ingredient ID: NPC8747

Ingredient ID: NPC87386

Ingredient ID: NPC7940

Ingredient ID: NPC76748

Ingredient ID: NPC76336

Ingredient ID: NPC73143

Ingredient ID: NPC68446

Ingredient ID: NPC67912

Ingredient ID: NPC62469

Ingredient ID: NPC57897

Ingredient ID: NPC57338

Ingredient ID: NPC55949

Ingredient ID: NPC53896

Ingredient ID: NPC52955

Ingredient ID: NPC51843

Ingredient ID: NPC51700

Ingredient ID: NPC51260

Ingredient ID: NPC41476

Ingredient ID: NPC34414

Ingredient ID: NPC33333

Ingredient ID: NPC329148

Ingredient ID: NPC324696

Ingredient ID: NPC322523

Ingredient ID: NPC319108

Ingredient ID: NPC317291

Ingredient ID: NPC31701

Ingredient ID: NPC316518

Ingredient ID: NPC311987

Ingredient ID: NPC309862

Ingredient ID: NPC302637

Ingredient ID: NPC301585

Ingredient ID: NPC299480

Ingredient ID: NPC299371

Ingredient ID: NPC294185

Ingredient ID: NPC288876

Ingredient ID: NPC288537

Ingredient ID: NPC28586

Ingredient ID: NPC282679

Ingredient ID: NPC282043

Ingredient ID: NPC281131

Ingredient ID: NPC279865

Ingredient ID: NPC279118

Ingredient ID: NPC277400

Ingredient ID: NPC275463

Ingredient ID: NPC271132

Ingredient ID: NPC26964

Ingredient ID: NPC269315

Ingredient ID: NPC267296

Ingredient ID: NPC266020

Ingredient ID: NPC265800

Ingredient ID: NPC264711

Ingredient ID: NPC264317

Ingredient ID: NPC26253

Ingredient ID: NPC261831

Ingredient ID: NPC257124

Ingredient ID: NPC255707

Ingredient ID: NPC255662

Ingredient ID: NPC25384

Ingredient ID: NPC250069

Ingredient ID: NPC244699

Ingredient ID: NPC241027

Ingredient ID: NPC235751

Ingredient ID: NPC235707

Ingredient ID: NPC234890

Ingredient ID: NPC227211

Ingredient ID: NPC225710

Ingredient ID: NPC225342

Ingredient ID: NPC225240

Ingredient ID: NPC223695

Ingredient ID: NPC22140

Ingredient ID: NPC218109

Ingredient ID: NPC216630

Ingredient ID: NPC214153

Ingredient ID: NPC20791

Ingredient ID: NPC206500

Ingredient ID: NPC20045

Ingredient ID: NPC198743

Ingredient ID: NPC198305

Ingredient ID: NPC197396

Ingredient ID: NPC196776

Ingredient ID: NPC195019

Ingredient ID: NPC193220

Ingredient ID: NPC190430

Ingredient ID: NPC184457

Ingredient ID: NPC179950

Ingredient ID: NPC179694

Ingredient ID: NPC176521

Ingredient ID: NPC173638

Ingredient ID: NPC173592

Ingredient ID: NPC171495

Ingredient ID: NPC165124

Ingredient ID: NPC1591

Ingredient ID: NPC156654

Ingredient ID: NPC142753

Ingredient ID: NPC142415

Ingredient ID: NPC137633

Ingredient ID: NPC137167

Ingredient ID: NPC135391

Ingredient ID: NPC135088

Ingredient ID: NPC133671

Ingredient ID: NPC131406

Ingredient ID: NPC130577

Ingredient ID: NPC128987

Ingredient ID: NPC124764

Ingredient ID: NPC120635

Ingredient ID: NPC120163

Ingredient ID: NPC118742

Ingredient ID: NPC116876

Ingredient ID: NPC112866

Ingredient ID: NPC111929

Ingredient ID: NPC111888

Ingredient ID: NPC111263

Ingredient ID: NPC110942

Ingredient ID: NPC100551