• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Ephedra Sinica


Example Image
PLANiTS DNA barcode

Click for details-----ITS

ATGTTTTTACAGGTACCCCAAGGTAGAGGACCGCGCGCTTTCCTGCTGAGCGGGTAACCGCTGAGTAAGTTCGCTCTCCGTTGAAGGAACCGGAAACTCTTGCAAGCGATATTCAAAAGCTGCAATCCCTCCGAGAATGGGGGGTCCATACGGTTTAATTCTGTGGACGGGGGAGAGCTTGTCCGTGTCTGTCCAGAGGGCCATGGGCGTTCCCTTGGCGGGACAACCGTGAAGCGGGAAAGAGGTGCGGGAATCTGCCCGTCATTACGGTCCCTCCTTTTAGGGAAGGAGAGGGATACGTTTGCGACACCGGTTGGCTTTCGGGACCGTGACTGCCGGGAAGAACTAGGGGAATGCGGGGACGTGGACGCCGTCCCGTCGCGGCGGACGCGGTTGGTGCGCGATGGGGGCGGATCTTACTTGCCGCTCAATGGGGCTTCCGCCCCGTCCCGTAGTAGTCGTCGGCCGCGGGGGGTGCGCGATGGGGGCGGATCTTACTTGCCGCTCACTGGGGCTTCCGCCCCGTCCCATCGTCGCCTCCTTTCCGGGGCGCCCTATTCCAATTTTTTACTCTGTAGAGAAAACTTGGGCCGGGAGTTCCGGCAAAGAGGGCGGGAGTACCGCCAAGGAAGCAATCTGGCAACGGCGCCGCGGGGTGATTCCTGAGGCCGCCCGCGCCAACGAAACGTACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTAGTGTGAATTGCAGAATCCCGTGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTCGGCCAAGGGCACGTCTGCCTGGGCGTCGCAAACCACAATTCGCCCCCCGGCTCATGTCGTCGGGGGGACGGCCTTGACCGTCCGGTCCGCCTCGGCGGTGCGGTCGGTTGAAATACAAAAGGGGACCTTCGCATGCTCTCCGACGGTGGGAGGTTGCGCATCGCGGCCCGCTTCCCGGGAGGGGTCGCATCCGGCACCGACCGTGCGGGAGATGCTGCGCGAGGTTTCCCGATCGGAAAAGGACTTCATCGAAGGCGGGAGTTATTCCCGTCACAG

Click for details-----ITS1

ATGTTTTTACAGGTACCCCAAGGTAGAGGACCGCGCGCTTTCCTGCTGAGCGGGTAACCGCTGAGTAAGTTCGCTCTCCGTTGAAGGAACCGGAAACTCTTGCAAGCGATATTCAAAAGCTGCAATCCCTCCGAGAATGGGGGGTCCATACGGTTTAATTCTGTGGACGGGGGAGAGCTTGTCCGTGTCTGTCCAGAGGGCCATGGGCGTTCCCTTGGCGGGACAACCGTGAAGCGGGAAAGAGGTGCGGGAATCTGCCCGTCATTACGGTCCCTCCTTTTAGGGAAGGAGAGGGATACGTTTGCGACACCGGTTGGCTTTCGGGACCGTGACTGCCGGGAAGAACTAGGGGAATGCGGGGACGTGGACGCCGTCCCGTCGCGGCGGACGCGGTTGGTGCGCGATGGGGGCGGATCTTACTTGCCGCTCAATGGGGCTTCCGCCCCGTCCCGTAGTAGTCGTCGGCCGCGGGGGGTGCGCGATGGGGGCGGATCTTACTTGCCGCTCACTGGGGCTTCCGCCCCGTCCCATCGTCGCCTCCTTTCCGGGGCGCCCTATTCCAATTTTTTACTCTGTAGAGAAAACTTGGGCCGGGAGTTCCGGCAAAGAGGGCGGGAGTACCGCCAAGGAAGCAATCTGGCAACGGCGCCGCGGGGTGATTCCTGAGGCCGCCCGCGCCAACGAAACGTA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO18176
Plant Latin Name: Ephedra Sinica
Taxonomy Genus: Ephedra
Taxonomy Family: Ephedraceae

Plant External Links:

NCBI TaxonomyDB: 33152
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China; South Korea; India

Traditional Medicine System:
Indian Folk; TCM; Kampo


Medicinal Functions:

Antidote; Cardiac; Diaphoretic; Diuretic; Pectoral; Vasoconstrictor; Vasodilator

Geographical Distribution

India; South Korea; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

372 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


261 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

153 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99325

Ingredient ID: NPC98555

Ingredient ID: NPC97716

Ingredient ID: NPC97117

Ingredient ID: NPC9639

Ingredient ID: NPC96222

Ingredient ID: NPC96146

Ingredient ID: NPC95039

Ingredient ID: NPC94857

Ingredient ID: NPC93843

Ingredient ID: NPC93761

Ingredient ID: NPC93292

Ingredient ID: NPC93219

Ingredient ID: NPC92656

Ingredient ID: NPC91842

Ingredient ID: NPC91560

Ingredient ID: NPC9117

Ingredient ID: NPC91036

Ingredient ID: NPC901

Ingredient ID: NPC89956

Ingredient ID: NPC88566

Ingredient ID: NPC87971

Ingredient ID: NPC86959

Ingredient ID: NPC86812

Ingredient ID: NPC85339

Ingredient ID: NPC84178

Ingredient ID: NPC82843

Ingredient ID: NPC8235

Ingredient ID: NPC81697

Ingredient ID: NPC80710

Ingredient ID: NPC80186

Ingredient ID: NPC80002

Ingredient ID: NPC78840

Ingredient ID: NPC78551

Ingredient ID: NPC78509

Ingredient ID: NPC78500

Ingredient ID: NPC78192

Ingredient ID: NPC78058

Ingredient ID: NPC78

Ingredient ID: NPC77660

Ingredient ID: NPC77379

Ingredient ID: NPC76336

Ingredient ID: NPC7605

Ingredient ID: NPC73198

Ingredient ID: NPC70854

Ingredient ID: NPC70628

Ingredient ID: NPC70410

Ingredient ID: NPC69934

Ingredient ID: NPC69860

Ingredient ID: NPC69541

Ingredient ID: NPC68889

Ingredient ID: NPC67167

Ingredient ID: NPC67004

Ingredient ID: NPC65540

Ingredient ID: NPC65528

Ingredient ID: NPC63867

Ingredient ID: NPC63697

Ingredient ID: NPC63684

Ingredient ID: NPC61457

Ingredient ID: NPC61321

Ingredient ID: NPC59445

Ingredient ID: NPC58342

Ingredient ID: NPC58137

Ingredient ID: NPC57605

Ingredient ID: NPC57067

Ingredient ID: NPC52955

Ingredient ID: NPC51725

Ingredient ID: NPC51326

Ingredient ID: NPC50898

Ingredient ID: NPC50742

Ingredient ID: NPC4960

Ingredient ID: NPC49151

Ingredient ID: NPC49056

Ingredient ID: NPC48624

Ingredient ID: NPC48448

Ingredient ID: NPC47283

Ingredient ID: NPC46248

Ingredient ID: NPC45908

Ingredient ID: NPC45141

Ingredient ID: NPC44745

Ingredient ID: NPC43728

Ingredient ID: NPC42716

Ingredient ID: NPC41770

Ingredient ID: NPC38497

Ingredient ID: NPC3752

Ingredient ID: NPC37250

Ingredient ID: NPC3649

Ingredient ID: NPC36054

Ingredient ID: NPC35038

Ingredient ID: NPC34125

Ingredient ID: NPC33815

Ingredient ID: NPC33546

Ingredient ID: NPC33489

Ingredient ID: NPC33258

Ingredient ID: NPC33159

Ingredient ID: NPC32739

Ingredient ID: NPC321239

Ingredient ID: NPC319650

Ingredient ID: NPC31941

Ingredient ID: NPC31786

Ingredient ID: NPC316232

Ingredient ID: NPC312132

Ingredient ID: NPC310996

Ingredient ID: NPC310538

Ingredient ID: NPC309501

Ingredient ID: NPC308050

Ingredient ID: NPC307784

Ingredient ID: NPC307041

Ingredient ID: NPC306829

Ingredient ID: NPC306686

Ingredient ID: NPC306258

Ingredient ID: NPC305078

Ingredient ID: NPC304761

Ingredient ID: NPC30433

Ingredient ID: NPC304078

Ingredient ID: NPC303611

Ingredient ID: NPC301917

Ingredient ID: NPC301585

Ingredient ID: NPC300933

Ingredient ID: NPC300798

Ingredient ID: NPC300205

Ingredient ID: NPC299027

Ingredient ID: NPC297358

Ingredient ID: NPC294592

Ingredient ID: NPC294409

Ingredient ID: NPC293799

Ingredient ID: NPC291724

Ingredient ID: NPC291545

Ingredient ID: NPC291070

Ingredient ID: NPC290515

Ingredient ID: NPC289917

Ingredient ID: NPC289832

Ingredient ID: NPC288466

Ingredient ID: NPC287902

Ingredient ID: NPC287505

Ingredient ID: NPC287331

Ingredient ID: NPC28683

Ingredient ID: NPC28677

Ingredient ID: NPC286400

Ingredient ID: NPC285555

Ingredient ID: NPC284039

Ingredient ID: NPC283274

Ingredient ID: NPC283083

Ingredient ID: NPC279508

Ingredient ID: NPC279495

Ingredient ID: NPC279121

Ingredient ID: NPC279028

Ingredient ID: NPC278683

Ingredient ID: NPC278552

Ingredient ID: NPC278068

Ingredient ID: NPC274769

Ingredient ID: NPC273607

Ingredient ID: NPC273306

Ingredient ID: NPC272471

Ingredient ID: NPC272405

Ingredient ID: NPC271803

Ingredient ID: NPC271438

Ingredient ID: NPC271118

Ingredient ID: NPC271027

Ingredient ID: NPC269340

Ingredient ID: NPC26906

Ingredient ID: NPC268725

Ingredient ID: NPC268580

Ingredient ID: NPC268564

Ingredient ID: NPC268204

Ingredient ID: NPC267901

Ingredient ID: NPC266383

Ingredient ID: NPC265496

Ingredient ID: NPC265376

Ingredient ID: NPC261245

Ingredient ID: NPC261080

Ingredient ID: NPC260382

Ingredient ID: NPC260197

Ingredient ID: NPC260061

Ingredient ID: NPC259512

Ingredient ID: NPC258494

Ingredient ID: NPC258019

Ingredient ID: NPC256006

Ingredient ID: NPC254679

Ingredient ID: NPC254238

Ingredient ID: NPC252379

Ingredient ID: NPC252067

Ingredient ID: NPC251059

Ingredient ID: NPC250893

Ingredient ID: NPC250242

Ingredient ID: NPC249606

Ingredient ID: NPC249046

Ingredient ID: NPC24821

Ingredient ID: NPC247553

Ingredient ID: NPC247455

Ingredient ID: NPC246810

Ingredient ID: NPC246757

Ingredient ID: NPC246513

Ingredient ID: NPC244016

Ingredient ID: NPC243579

Ingredient ID: NPC242893

Ingredient ID: NPC242074

Ingredient ID: NPC240809

Ingredient ID: NPC239406

Ingredient ID: NPC238140

Ingredient ID: NPC236657

Ingredient ID: NPC235941

Ingredient ID: NPC235575

Ingredient ID: NPC235217

Ingredient ID: NPC233533

Ingredient ID: NPC233222

Ingredient ID: NPC231194

Ingredient ID: NPC230302

Ingredient ID: NPC230271

Ingredient ID: NPC230221

Ingredient ID: NPC229687

Ingredient ID: NPC229253

Ingredient ID: NPC229235

Ingredient ID: NPC229

Ingredient ID: NPC228400

Ingredient ID: NPC227250

Ingredient ID: NPC227211

Ingredient ID: NPC226779

Ingredient ID: NPC226778

Ingredient ID: NPC226096

Ingredient ID: NPC225731

Ingredient ID: NPC225660

Ingredient ID: NPC225281

Ingredient ID: NPC225060

Ingredient ID: NPC224573

Ingredient ID: NPC223812

Ingredient ID: NPC223787

Ingredient ID: NPC223695

Ingredient ID: NPC223673

Ingredient ID: NPC223455

Ingredient ID: NPC217372

Ingredient ID: NPC216630

Ingredient ID: NPC216538

Ingredient ID: NPC215917

Ingredient ID: NPC214584

Ingredient ID: NPC214201

Ingredient ID: NPC214200

Ingredient ID: NPC214125

Ingredient ID: NPC214067

Ingredient ID: NPC213749

Ingredient ID: NPC213570

Ingredient ID: NPC213

Ingredient ID: NPC212748

Ingredient ID: NPC212489

Ingredient ID: NPC211309

Ingredient ID: NPC210902

Ingredient ID: NPC210498

Ingredient ID: NPC209560

Ingredient ID: NPC208984

Ingredient ID: NPC208941

Ingredient ID: NPC208936

Ingredient ID: NPC208683

Ingredient ID: NPC20791

Ingredient ID: NPC206007

Ingredient ID: NPC205289

Ingredient ID: NPC204654

Ingredient ID: NPC203945

Ingredient ID: NPC202324

Ingredient ID: NPC202236

Ingredient ID: NPC2016

Ingredient ID: NPC201182

Ingredient ID: NPC199972

Ingredient ID: NPC19898

Ingredient ID: NPC19733

Ingredient ID: NPC196431

Ingredient ID: NPC195763

Ingredient ID: NPC192989

Ingredient ID: NPC190810

Ingredient ID: NPC190530

Ingredient ID: NPC18693

Ingredient ID: NPC186928

Ingredient ID: NPC182840

Ingredient ID: NPC180401

Ingredient ID: NPC180102

Ingredient ID: NPC178632

Ingredient ID: NPC1786

Ingredient ID: NPC178041

Ingredient ID: NPC176846

Ingredient ID: NPC176790

Ingredient ID: NPC176740

Ingredient ID: NPC176464

Ingredient ID: NPC175229

Ingredient ID: NPC175222

Ingredient ID: NPC173365

Ingredient ID: NPC171489

Ingredient ID: NPC168017

Ingredient ID: NPC16754

Ingredient ID: NPC167531

Ingredient ID: NPC167387

Ingredient ID: NPC167137

Ingredient ID: NPC165651

Ingredient ID: NPC165525

Ingredient ID: NPC164980

Ingredient ID: NPC164907

Ingredient ID: NPC164708

Ingredient ID: NPC164514

Ingredient ID: NPC163556

Ingredient ID: NPC161785

Ingredient ID: NPC161439

Ingredient ID: NPC159560

Ingredient ID: NPC158121

Ingredient ID: NPC157884

Ingredient ID: NPC157265

Ingredient ID: NPC155486

Ingredient ID: NPC155251

Ingredient ID: NPC154185

Ingredient ID: NPC153979

Ingredient ID: NPC153439

Ingredient ID: NPC150254

Ingredient ID: NPC149436

Ingredient ID: NPC14929

Ingredient ID: NPC148825

Ingredient ID: NPC14757

Ingredient ID: NPC147209

Ingredient ID: NPC147062

Ingredient ID: NPC147000

Ingredient ID: NPC145707

Ingredient ID: NPC144714

Ingredient ID: NPC144403

Ingredient ID: NPC143578

Ingredient ID: NPC143344

Ingredient ID: NPC143253

Ingredient ID: NPC141791

Ingredient ID: NPC14002

Ingredient ID: NPC138925

Ingredient ID: NPC138113

Ingredient ID: NPC137742

Ingredient ID: NPC137050

Ingredient ID: NPC136909

Ingredient ID: NPC131579

Ingredient ID: NPC131568

Ingredient ID: NPC131464

Ingredient ID: NPC130398

Ingredient ID: NPC129654

Ingredient ID: NPC127430

Ingredient ID: NPC127122

Ingredient ID: NPC127059

Ingredient ID: NPC126853

Ingredient ID: NPC125935

Ingredient ID: NPC124830

Ingredient ID: NPC124359

Ingredient ID: NPC123391

Ingredient ID: NPC122962

Ingredient ID: NPC122355

Ingredient ID: NPC121921

Ingredient ID: NPC121813

Ingredient ID: NPC120699

Ingredient ID: NPC117842

Ingredient ID: NPC116906

Ingredient ID: NPC116775

Ingredient ID: NPC116199

Ingredient ID: NPC115568

Ingredient ID: NPC114368

Ingredient ID: NPC114239

Ingredient ID: NPC11422

Ingredient ID: NPC111782

Ingredient ID: NPC108831

Ingredient ID: NPC108607

Ingredient ID: NPC108606

Ingredient ID: NPC108561

Ingredient ID: NPC108418

Ingredient ID: NPC107899

Ingredient ID: NPC10754

Ingredient ID: NPC107177

Ingredient ID: NPC10519

Ingredient ID: NPC104593

Ingredient ID: NPC103700

Ingredient ID: NPC10286

Ingredient ID: NPC10285

Ingredient ID: NPC102803

Ingredient ID: NPC100773

Ingredient ID: NPC100445