• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Dalbergia Odorifera


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

NA

Click for details-----ITS2

ATCGCCGCCCCAACCCCTGTGCCTCCGGCCACGGAGCGGGGCGAATGCTGGCCTCCCGTGAGCACCGCCTCGGGGCTGGCTGAAAATCGGGTTCGTGGTGGATGCAGCGCCATGTCAGACGGTGGTTGAGCGTGTTCTCGAGGCCAGTCATGAGGGCGGCCTCCACCAGCTCCGTACCCAGCGACCCGCGAGCGATGTCGCTCGCCCACGACGCGACCTCAGGTTCAGGCGGGGCTA
Taxonomic Information

Plant ID: NPO18117
Plant Latin Name: Dalbergia Odorifera
Taxonomy Genus: Dalbergia
Taxonomy Family: Fabaceae

Plant External Links:

NCBI TaxonomyDB: 499988
Plant-of-the-World-Online: 490369-1

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM

Geographical Distribution

China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

137 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


127 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

85 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC96856

Ingredient ID: NPC91492

Ingredient ID: NPC90254

Ingredient ID: NPC88072

Ingredient ID: NPC79943

Ingredient ID: NPC79273

Ingredient ID: NPC74925

Ingredient ID: NPC73698

Ingredient ID: NPC73061

Ingredient ID: NPC69271

Ingredient ID: NPC67903

Ingredient ID: NPC67761

Ingredient ID: NPC67585

Ingredient ID: NPC6451

Ingredient ID: NPC60885

Ingredient ID: NPC56840

Ingredient ID: NPC55162

Ingredient ID: NPC51758

Ingredient ID: NPC51443

Ingredient ID: NPC49242

Ingredient ID: NPC47283

Ingredient ID: NPC471229

Ingredient ID: NPC464

Ingredient ID: NPC43728

Ingredient ID: NPC39426

Ingredient ID: NPC39064

Ingredient ID: NPC38874

Ingredient ID: NPC38065

Ingredient ID: NPC34245

Ingredient ID: NPC33284

Ingredient ID: NPC329225

Ingredient ID: NPC328042

Ingredient ID: NPC325646

Ingredient ID: NPC32441

Ingredient ID: NPC32313

Ingredient ID: NPC32222

Ingredient ID: NPC319777

Ingredient ID: NPC319608

Ingredient ID: NPC31898

Ingredient ID: NPC318322

Ingredient ID: NPC311485

Ingredient ID: NPC31018

Ingredient ID: NPC308694

Ingredient ID: NPC306149

Ingredient ID: NPC303967

Ingredient ID: NPC303644

Ingredient ID: NPC303185

Ingredient ID: NPC301006

Ingredient ID: NPC299520

Ingredient ID: NPC299011

Ingredient ID: NPC298869

Ingredient ID: NPC295697

Ingredient ID: NPC295593

Ingredient ID: NPC292214

Ingredient ID: NPC292179

Ingredient ID: NPC291116

Ingredient ID: NPC28951

Ingredient ID: NPC287246

Ingredient ID: NPC285067

Ingredient ID: NPC283389

Ingredient ID: NPC279121

Ingredient ID: NPC277907

Ingredient ID: NPC274468

Ingredient ID: NPC267117

Ingredient ID: NPC26697

Ingredient ID: NPC265871

Ingredient ID: NPC257756

Ingredient ID: NPC256555

Ingredient ID: NPC255807

Ingredient ID: NPC248727

Ingredient ID: NPC243083

Ingredient ID: NPC242893

Ingredient ID: NPC236637

Ingredient ID: NPC234865

Ingredient ID: NPC234560

Ingredient ID: NPC230124

Ingredient ID: NPC224157

Ingredient ID: NPC221673

Ingredient ID: NPC218493

Ingredient ID: NPC217840

Ingredient ID: NPC210796

Ingredient ID: NPC210084

Ingredient ID: NPC209560

Ingredient ID: NPC209279

Ingredient ID: NPC205586

Ingredient ID: NPC205093

Ingredient ID: NPC19980

Ingredient ID: NPC199170

Ingredient ID: NPC195763

Ingredient ID: NPC194626

Ingredient ID: NPC194586

Ingredient ID: NPC192687

Ingredient ID: NPC191741

Ingredient ID: NPC19174

Ingredient ID: NPC183959

Ingredient ID: NPC183655

Ingredient ID: NPC182421

Ingredient ID: NPC181960

Ingredient ID: NPC179686

Ingredient ID: NPC17807

Ingredient ID: NPC175552

Ingredient ID: NPC173660

Ingredient ID: NPC172997

Ingredient ID: NPC172090

Ingredient ID: NPC162237

Ingredient ID: NPC1612

Ingredient ID: NPC16087

Ingredient ID: NPC156953

Ingredient ID: NPC155828

Ingredient ID: NPC153363

Ingredient ID: NPC151898

Ingredient ID: NPC150648

Ingredient ID: NPC148491

Ingredient ID: NPC147686

Ingredient ID: NPC14092

Ingredient ID: NPC140840

Ingredient ID: NPC140395

Ingredient ID: NPC139364

Ingredient ID: NPC137880

Ingredient ID: NPC13768

Ingredient ID: NPC134178

Ingredient ID: NPC133501

Ingredient ID: NPC131877

Ingredient ID: NPC130314

Ingredient ID: NPC12588

Ingredient ID: NPC12175

Ingredient ID: NPC12090

Ingredient ID: NPC120488

Ingredient ID: NPC117584

Ingredient ID: NPC115023

Ingredient ID: NPC114171

Ingredient ID: NPC113733

Ingredient ID: NPC111888

Ingredient ID: NPC110420

Ingredient ID: NPC108494

Ingredient ID: NPC106215

Ingredient ID: NPC101804