• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Crinum Bulbispermum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

NA

Click for details-----ITS2

CTGTGACGCTTCGCGCCCCTTGCCCCTTACCTGGTGTAGGTGGCAACTGGTTCGAACGTGGAGATTGGCCCCCTGTGCATCATCGCGCGGTGGGTTGAAGTGTGGGCCGTTGGCGGGCCGGATGCGGCGAGTGGTGGAGAAGACACGCACGGCGTCGTTGAAGTTGCCTGCTCTGAACGGTGCATTGGAGGACCCATGCTGGTGGTGCGAGTTGAGCTCCCTTGAACAAGATCGCAGGTCAG
Taxonomic Information

Plant ID: NPO18113
Plant Latin Name: Crinum Bulbispermum
Taxonomy Genus: Crinum
Taxonomy Family: Amaryllidaceae

Plant External Links:

NCBI TaxonomyDB: 209086
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
South Africa

Traditional Medicine System:

Geographical Distribution

South Africa

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

10 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


9 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

6 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC82533

Ingredient ID: NPC36241

Ingredient ID: NPC30741

Ingredient ID: NPC252349

Ingredient ID: NPC225597

Ingredient ID: NPC222342

Ingredient ID: NPC210138

Ingredient ID: NPC19174

Ingredient ID: NPC170388

Ingredient ID: NPC161187