• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Geranium Nepalense


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAACCCTGCACAGCAGAACGACCCGCGAACTCGTTAACAAACTGCGGGGAGCGGGTGGCGTCTGCGCCCCCCGCAACTCGATGTCGGGGGCTTGGGCGGAAGCCCACGCTGCCCGACAAAAAACGTACCCCCGGCGCGGTCCGCGCCAAGGAATCGAAACGAAGCAACGTGTGCAGTCTGCCCCGTTCGCGGGAAGTGGACGGCAACACGGTCTTCTAATGTATACTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCGCTCCGTCGCCCCGCAACCCCGAACTCCGAAATGGGCCAGGGTGCTTGTGGTGCGGAGATTGGTCTCCCGTGTGCCTTGCTCGCGGCTGGCCTAAAATTGAGTCCCGGACGCTCTGTTCTGCGGCCGACGGTGGTTGAGAAGCCCTCGAAAATGTGCTGCTGCAGTGTTGCCCGATGTGGACCCTGTGACCCTCGCGCGACCTCTCCCCCCCTTGGGGTGAGGGAGCTCCATCTGAGA

Click for details-----ITS1

NA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO18042
Plant Latin Name: Geranium Nepalense
Taxonomy Genus: Geranium
Taxonomy Family: Geraniaceae

Plant External Links:

NCBI TaxonomyDB: 54667
Plant-of-the-World-Online: 373372-1

Used in Medicines

Country/Region:
China; India

Traditional Medicine System:
Indian Folk; TCM


Medicinal Functions:

Antibacterial; Astringent

Geographical Distribution

Brazil; Afghanistan; Australia; Myanmar; Pakistan; Indonesia; India; South Africa; United States; Vietnam; China; Laos; Sri Lanka; Thailand; Nepal

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

17 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


14 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

10 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99274

Ingredient ID: NPC78944

Ingredient ID: NPC71074

Ingredient ID: NPC51700

Ingredient ID: NPC30789

Ingredient ID: NPC299820

Ingredient ID: NPC259733

Ingredient ID: NPC251065

Ingredient ID: NPC239113

Ingredient ID: NPC22130

Ingredient ID: NPC184624

Ingredient ID: NPC180553

Ingredient ID: NPC162099

Ingredient ID: NPC161557

Ingredient ID: NPC158371

Ingredient ID: NPC15212

Ingredient ID: NPC105609