• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Isodon Scoparius


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

TCGAAACCTGCAAAGCAGACCGCGAACACGTTTCTAACGCCATCCTCCGCCGCAGCGCGCGCACTAGTGCCGCGCGGCGTGCGGGCTAACGAACCCCGGCGCGGAACGCGCCAAGGAAAACTTAAATTTAGCGTCGGTCTCGCCCCGCATCCCGTTCGCGGGCCGTGCGGTGCGGAACGGGCGTCTATCGAATGTCATAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO18028
Plant Latin Name: Isodon Scoparius
Taxonomy Genus: Isodon
Taxonomy Family: Lamiaceae

Plant External Links:

NCBI TaxonomyDB: 662927
Plant-of-the-World-Online: 915160-1

Used in Medicines

Unknown.

Geographical Distribution

China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

36 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


31 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

33 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC94650

Ingredient ID: NPC91772

Ingredient ID: NPC75238

Ingredient ID: NPC64006

Ingredient ID: NPC55503

Ingredient ID: NPC483249

Ingredient ID: NPC483248

Ingredient ID: NPC483247

Ingredient ID: NPC483246

Ingredient ID: NPC483245

Ingredient ID: NPC483244

Ingredient ID: NPC483243

Ingredient ID: NPC483242

Ingredient ID: NPC483241

Ingredient ID: NPC483240

Ingredient ID: NPC483239

Ingredient ID: NPC483238

Ingredient ID: NPC478501

Ingredient ID: NPC476296

Ingredient ID: NPC476294

Ingredient ID: NPC476168

Ingredient ID: NPC29112

Ingredient ID: NPC280804

Ingredient ID: NPC279643

Ingredient ID: NPC231278

Ingredient ID: NPC208553

Ingredient ID: NPC191094

Ingredient ID: NPC181594

Ingredient ID: NPC173413

Ingredient ID: NPC17140

Ingredient ID: NPC156324

Ingredient ID: NPC144486

Ingredient ID: NPC138245

Ingredient ID: NPC129004

Ingredient ID: NPC127408

Ingredient ID: NPC101233